Mutagenetix > Incidental Mutation

Incidental Mutation 'R2254:Capn3'

241851

Institutional Source

Beutler Lab

Gene Symbol

Capn3

Ensembl Gene

ENSMUSG00000079110

Gene Name

calpain 3

Synonyms

Capa-3, Capa3, Lp82, p94

MMRRC Submission

040254-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R2254 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120456019-120504913 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120501251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 614 (E614G)

Ref Sequence

ENSEMBL: ENSMUSP00000028749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028748] [ENSMUST00000028749] [ENSMUST00000090028] [ENSMUST00000110716] [ENSMUST00000110719] [ENSMUST00000110721]

AlphaFold

Q64691

Predicted Effect

probably benign
Transcript: ENSMUST00000028748

SMART Domains

Protein: ENSMUSP00000028748
Gene: ENSMUSG00000079110

Domain	Start	End	E-Value	Type
CysPc	32	357	5.98e-199	SMART
calpain_III	360	514	4.27e-90	SMART
EFh	584	612	5.53e-4	SMART
EFh	614	642	1.8e-3	SMART
EFh	679	707	4.32e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000028749
AA Change: E614G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000028749
Gene: ENSMUSG00000079110
AA Change: E614G

Domain	Start	End	E-Value	Type
CysPc	56	425	2.09e-212	SMART
calpain_III	428	582	4.27e-90	SMART
Pfam:Calpain_u2	583	653	1.3e-31	PFAM
EFh	696	724	5.53e-4	SMART
EFh	726	754	1.8e-3	SMART
EFh	791	819	4.32e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090028

SMART Domains

Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110

Domain	Start	End	E-Value	Type
CysPc	32	357	5.98e-199	SMART
calpain_III	360	514	4.27e-90	SMART
low complexity region	585	599	N/A	INTRINSIC
EFh	612	640	5.53e-4	SMART
EFh	642	670	1.8e-3	SMART
EFh	707	735	4.32e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110716

SMART Domains

Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110

Domain	Start	End	E-Value	Type
CysPc	32	405	8.38e-203	SMART
calpain_III	408	562	4.27e-90	SMART
EFh	632	660	5.53e-4	SMART
EFh	662	690	1.8e-3	SMART
EFh	727	755	4.32e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110719

SMART Domains

Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110

Domain	Start	End	E-Value	Type
CysPc	32	405	8.38e-203	SMART
calpain_III	408	562	4.27e-90	SMART
low complexity region	633	647	N/A	INTRINSIC
EFh	660	688	5.53e-4	SMART
EFh	690	718	1.8e-3	SMART
EFh	755	783	4.32e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110721

SMART Domains

Protein: ENSMUSP00000106349
Gene: ENSMUSG00000079110

Domain	Start	End	E-Value	Type
CysPc	56	377	1.13e-208	SMART
calpain_III	380	534	4.27e-90	SMART
EFh	604	632	5.53e-4	SMART
EFh	634	662	1.8e-3	SMART
EFh	699	727	4.32e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125238

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139336

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151342

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in muscle dystrophy. The psoas, soleus, and deltoid muscles are the most severely affected. The mutant allele appears to be preferentially transmitted resulting in ratio distortion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	G	T	7: 131,222,905	C243F	probably damaging	Het
Actn2	T	C	13: 12,296,479	E260G	probably benign	Het
AI429214	G	T	8: 36,993,766	D23Y	possibly damaging	Het
Alms1	A	G	6: 85,619,848	Y1021C	probably damaging	Het
Ang5	A	G	14: 43,962,617	D46G	probably benign	Het
Ano9	T	A	7: 141,103,090	D635V	probably benign	Het
Apob	C	T	12: 8,011,256	T3246I	possibly damaging	Het
Arhgef25	T	C	10: 127,189,521	E63G	probably benign	Het
B3gnt4	A	C	5: 123,511,279	I236L	probably damaging	Het
Bmper	T	A	9: 23,381,463	I356N	possibly damaging	Het
Ccdc90b	T	A	7: 92,572,568	H118Q	probably damaging	Het
Cdh2	A	T	18: 16,643,928		probably null	Het
Chmp7	C	T	14: 69,720,956	V255I	probably damaging	Het
Dnhd1	T	A	7: 105,703,772	S2711T	probably damaging	Het
Gabrg1	T	A	5: 70,782,364	K137*	probably null	Het
Gdi2	T	A	13: 3,554,400		probably null	Het
Glyr1	A	G	16: 5,019,013	V429A	probably benign	Het
Gm5938	T	A	X: 78,128,555		probably null	Het
Golt1b	T	C	6: 142,396,253	L121P	probably damaging	Het
Gpi1	T	C	7: 34,202,877	N471S	probably damaging	Het
Ifi204	G	A	1: 173,761,730	T45M	possibly damaging	Het
Il18r1	A	G	1: 40,491,220	N369S	possibly damaging	Het
Kcnh1	G	T	1: 192,505,414		probably null	Het
Kitl	G	A	10: 100,080,131		probably null	Het
Krt33a	A	T	11: 100,014,178	D167E	possibly damaging	Het
Lax1	A	G	1: 133,680,233	S257P	probably damaging	Het
Lepr	T	C	4: 101,815,112	I1111T	probably benign	Het
Lrrcc1	G	A	3: 14,547,255	R356H	probably damaging	Het
Map1a	A	G	2: 121,303,791	D1458G	possibly damaging	Het
Med11	T	C	11: 70,452,095		probably null	Het
Mtmr2	T	C	9: 13,796,057	Y230H	possibly damaging	Het
Nup93	T	C	8: 94,227,857		probably null	Het
Olfr610	A	G	7: 103,506,064	V294A	probably damaging	Het
Ovch2	A	G	7: 107,790,195	V342A	probably benign	Het
Ovgp1	A	G	3: 105,986,912		probably benign	Het
Oxtr	A	T	6: 112,489,106	L231Q	probably damaging	Het
Prap1	A	G	7: 140,096,162	T30A	probably damaging	Het
Scg2	G	A	1: 79,436,500	P169S	probably damaging	Het
Scube2	A	G	7: 109,825,459	V549A	possibly damaging	Het
Slc22a12	A	T	19: 6,542,541	V57D	possibly damaging	Het
Slc22a28	A	C	19: 8,064,493	C450G	probably benign	Het
Tas2r120	A	T	6: 132,657,609	Q218L	probably benign	Het
Tbx15	A	G	3: 99,351,874	T354A	possibly damaging	Het
Trim24	A	G	6: 37,958,677	T868A	probably benign	Het
Ttn	T	A	2: 76,768,340	M19410L	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Upb1	G	A	10: 75,436,217	R288H	probably damaging	Het
Wdr20rt	T	A	12: 65,226,233	W56R	probably damaging	Het
Wdr62	T	G	7: 30,267,903	I309L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp40	T	C	17: 23,178,370	D51G	possibly damaging	Het
Zfp64	G	A	2: 168,926,742	H317Y	probably damaging	Het

Other mutations in Capn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Capn3	APN	2	120486482	intron	probably benign
IGL00976:Capn3	APN	2	120491901	missense	possibly damaging	0.81
IGL01538:Capn3	APN	2	120502186	splice site	probably null
IGL01564:Capn3	APN	2	120480708	missense	probably damaging	1.00
IGL02527:Capn3	APN	2	120504485	missense	probably damaging	0.99
IGL02605:Capn3	APN	2	120496037	missense	probably damaging	0.98
IGL02678:Capn3	APN	2	120502998	missense	probably damaging	1.00
IGL02899:Capn3	APN	2	120491901	missense	possibly damaging	0.81
IGL03255:Capn3	APN	2	120489708	missense	probably damaging	1.00
R0053:Capn3	UTSW	2	120491837	missense	possibly damaging	0.95
R0053:Capn3	UTSW	2	120491837	missense	possibly damaging	0.95
R0096:Capn3	UTSW	2	120502529	missense	possibly damaging	0.94
R0096:Capn3	UTSW	2	120502529	missense	possibly damaging	0.94
R0276:Capn3	UTSW	2	120488065	splice site	probably benign
R0601:Capn3	UTSW	2	120502596	splice site	probably null
R0714:Capn3	UTSW	2	120491880	missense	probably benign	0.32
R1217:Capn3	UTSW	2	120486421	nonsense	probably null
R1530:Capn3	UTSW	2	120482208	missense	probably damaging	1.00
R1566:Capn3	UTSW	2	120502993	missense	possibly damaging	0.72
R1745:Capn3	UTSW	2	120489689	missense	possibly damaging	0.87
R1748:Capn3	UTSW	2	120497013	missense	probably benign	0.10
R1861:Capn3	UTSW	2	120486482	intron	probably benign
R1960:Capn3	UTSW	2	120463940	missense	probably benign	0.00
R1971:Capn3	UTSW	2	120480747	missense	possibly damaging	0.95
R1994:Capn3	UTSW	2	120495937	missense	probably damaging	1.00
R2043:Capn3	UTSW	2	120491901	missense	possibly damaging	0.81
R2255:Capn3	UTSW	2	120501251	missense	probably benign	0.01
R3738:Capn3	UTSW	2	120485287	missense	possibly damaging	0.85
R3824:Capn3	UTSW	2	120484483	splice site	probably benign
R4796:Capn3	UTSW	2	120502998	missense	probably damaging	1.00
R5073:Capn3	UTSW	2	120491820	missense	probably damaging	1.00
R5116:Capn3	UTSW	2	120485292	missense	probably benign	0.00
R5152:Capn3	UTSW	2	120501330	intron	probably benign
R5420:Capn3	UTSW	2	120495296	intron	probably benign
R5478:Capn3	UTSW	2	120464185	splice site	probably null
R5506:Capn3	UTSW	2	120502420	missense	probably damaging	0.97
R5664:Capn3	UTSW	2	120477025	missense	probably benign	0.04
R5733:Capn3	UTSW	2	120484594	nonsense	probably null
R6212:Capn3	UTSW	2	120477186	missense	probably benign	0.17
R7176:Capn3	UTSW	2	120504492	missense	possibly damaging	0.46
R7219:Capn3	UTSW	2	120503454	missense	probably damaging	0.99
R7365:Capn3	UTSW	2	120494814	missense	probably damaging	0.98
R7819:Capn3	UTSW	2	120464165	missense	probably benign	0.05
R8052:Capn3	UTSW	2	120486386	missense	probably benign
R8834:Capn3	UTSW	2	120464053	missense	probably damaging	0.98
R8970:Capn3	UTSW	2	120464085	missense	possibly damaging	0.90
R9088:Capn3	UTSW	2	120490970	missense	probably benign
R9473:Capn3	UTSW	2	120496054	nonsense	probably null
R9512:Capn3	UTSW	2	120496054	missense	probably damaging	0.99
R9663:Capn3	UTSW	2	120486378	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGTTTGGCATGTCTCCTAG -3'
(R):5'- ACAGTGCTGAAGAGACCCTC -3'

Sequencing Primer
(F):5'- TTCAGAAATGGGACTCAGGCTTC -3'
(R):5'- TGAAGAGACCCTCCCCTGAGAG -3'

Posted On

2014-10-16