Mutagenetix > Incidental Mutation

Incidental Mutation 'R2254:Tbx15'

241856

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

040254-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R2254 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99351874 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 354 (T354A)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: T354A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: T354A

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	G	T	7: 131,222,905	C243F	probably damaging	Het
Actn2	T	C	13: 12,296,479	E260G	probably benign	Het
AI429214	G	T	8: 36,993,766	D23Y	possibly damaging	Het
Alms1	A	G	6: 85,619,848	Y1021C	probably damaging	Het
Ang5	A	G	14: 43,962,617	D46G	probably benign	Het
Ano9	T	A	7: 141,103,090	D635V	probably benign	Het
Apob	C	T	12: 8,011,256	T3246I	possibly damaging	Het
Arhgef25	T	C	10: 127,189,521	E63G	probably benign	Het
B3gnt4	A	C	5: 123,511,279	I236L	probably damaging	Het
Bmper	T	A	9: 23,381,463	I356N	possibly damaging	Het
Capn3	A	G	2: 120,501,251	E614G	probably benign	Het
Ccdc90b	T	A	7: 92,572,568	H118Q	probably damaging	Het
Cdh2	A	T	18: 16,643,928		probably null	Het
Chmp7	C	T	14: 69,720,956	V255I	probably damaging	Het
Dnhd1	T	A	7: 105,703,772	S2711T	probably damaging	Het
Gabrg1	T	A	5: 70,782,364	K137*	probably null	Het
Gdi2	T	A	13: 3,554,400		probably null	Het
Glyr1	A	G	16: 5,019,013	V429A	probably benign	Het
Gm5938	T	A	X: 78,128,555		probably null	Het
Golt1b	T	C	6: 142,396,253	L121P	probably damaging	Het
Gpi1	T	C	7: 34,202,877	N471S	probably damaging	Het
Ifi204	G	A	1: 173,761,730	T45M	possibly damaging	Het
Il18r1	A	G	1: 40,491,220	N369S	possibly damaging	Het
Kcnh1	G	T	1: 192,505,414		probably null	Het
Kitl	G	A	10: 100,080,131		probably null	Het
Krt33a	A	T	11: 100,014,178	D167E	possibly damaging	Het
Lax1	A	G	1: 133,680,233	S257P	probably damaging	Het
Lepr	T	C	4: 101,815,112	I1111T	probably benign	Het
Lrrcc1	G	A	3: 14,547,255	R356H	probably damaging	Het
Map1a	A	G	2: 121,303,791	D1458G	possibly damaging	Het
Med11	T	C	11: 70,452,095		probably null	Het
Mtmr2	T	C	9: 13,796,057	Y230H	possibly damaging	Het
Nup93	T	C	8: 94,227,857		probably null	Het
Olfr610	A	G	7: 103,506,064	V294A	probably damaging	Het
Ovch2	A	G	7: 107,790,195	V342A	probably benign	Het
Ovgp1	A	G	3: 105,986,912		probably benign	Het
Oxtr	A	T	6: 112,489,106	L231Q	probably damaging	Het
Prap1	A	G	7: 140,096,162	T30A	probably damaging	Het
Scg2	G	A	1: 79,436,500	P169S	probably damaging	Het
Scube2	A	G	7: 109,825,459	V549A	possibly damaging	Het
Slc22a12	A	T	19: 6,542,541	V57D	possibly damaging	Het
Slc22a28	A	C	19: 8,064,493	C450G	probably benign	Het
Tas2r120	A	T	6: 132,657,609	Q218L	probably benign	Het
Trim24	A	G	6: 37,958,677	T868A	probably benign	Het
Ttn	T	A	2: 76,768,340	M19410L	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Upb1	G	A	10: 75,436,217	R288H	probably damaging	Het
Wdr20rt	T	A	12: 65,226,233	W56R	probably damaging	Het
Wdr62	T	G	7: 30,267,903	I309L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp40	T	C	17: 23,178,370	D51G	possibly damaging	Het
Zfp64	G	A	2: 168,926,742	H317Y	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTACTGGTCTCATGCCATC -3'
(R):5'- GCATGAAGGTTTCAGAGGGC -3'

Sequencing Primer
(F):5'- ACTGGTCTCATGCCATCCCTATC -3'
(R):5'- TCAGCCCTGGATAGCTCTGTAAG -3'

Posted On

2014-10-16