Incidental Mutation 'R2254:Tbx15'
ID 241856
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 040254-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R2254 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99259190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 354 (T354A)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: T354A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: T354A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,311,365 (GRCm39) E260G probably benign Het
AI429214 G T 8: 37,460,920 (GRCm39) D23Y possibly damaging Het
Alms1 A G 6: 85,596,830 (GRCm39) Y1021C probably damaging Het
Ang5 A G 14: 44,200,074 (GRCm39) D46G probably benign Het
Ano9 T A 7: 140,683,003 (GRCm39) D635V probably benign Het
Apob C T 12: 8,061,256 (GRCm39) T3246I possibly damaging Het
Arhgef25 T C 10: 127,025,390 (GRCm39) E63G probably benign Het
B3gnt4 A C 5: 123,649,342 (GRCm39) I236L probably damaging Het
Bmper T A 9: 23,292,759 (GRCm39) I356N possibly damaging Het
Capn3 A G 2: 120,331,732 (GRCm39) E614G probably benign Het
Ccdc90b T A 7: 92,221,776 (GRCm39) H118Q probably damaging Het
Cdcp3 G T 7: 130,824,634 (GRCm39) C243F probably damaging Het
Cdh2 A T 18: 16,776,985 (GRCm39) probably null Het
Chmp7 C T 14: 69,958,405 (GRCm39) V255I probably damaging Het
Dnhd1 T A 7: 105,352,979 (GRCm39) S2711T probably damaging Het
Gabrg1 T A 5: 70,939,707 (GRCm39) K137* probably null Het
Gdi2 T A 13: 3,604,400 (GRCm39) probably null Het
Glyr1 A G 16: 4,836,877 (GRCm39) V429A probably benign Het
Gm5938 T A X: 77,172,161 (GRCm39) probably null Het
Golt1b T C 6: 142,341,979 (GRCm39) L121P probably damaging Het
Gpi1 T C 7: 33,902,302 (GRCm39) N471S probably damaging Het
Ifi204 G A 1: 173,589,296 (GRCm39) T45M possibly damaging Het
Il18r1 A G 1: 40,530,380 (GRCm39) N369S possibly damaging Het
Kcnh1 G T 1: 192,187,722 (GRCm39) probably null Het
Kitl G A 10: 99,915,993 (GRCm39) probably null Het
Krt33a A T 11: 99,905,004 (GRCm39) D167E possibly damaging Het
Lax1 A G 1: 133,607,971 (GRCm39) S257P probably damaging Het
Lepr T C 4: 101,672,309 (GRCm39) I1111T probably benign Het
Lrrcc1 G A 3: 14,612,315 (GRCm39) R356H probably damaging Het
Map1a A G 2: 121,134,272 (GRCm39) D1458G possibly damaging Het
Med11 T C 11: 70,342,921 (GRCm39) probably null Het
Mtmr2 T C 9: 13,707,353 (GRCm39) Y230H possibly damaging Het
Nup93 T C 8: 94,954,485 (GRCm39) probably null Het
Or51ag1 A G 7: 103,155,271 (GRCm39) V294A probably damaging Het
Ovch2 A G 7: 107,389,402 (GRCm39) V342A probably benign Het
Ovgp1 A G 3: 105,894,228 (GRCm39) probably benign Het
Oxtr A T 6: 112,466,067 (GRCm39) L231Q probably damaging Het
Prap1 A G 7: 139,676,075 (GRCm39) T30A probably damaging Het
Scg2 G A 1: 79,414,217 (GRCm39) P169S probably damaging Het
Scube2 A G 7: 109,424,666 (GRCm39) V549A possibly damaging Het
Slc22a12 A T 19: 6,592,571 (GRCm39) V57D possibly damaging Het
Slc22a28 A C 19: 8,041,858 (GRCm39) C450G probably benign Het
Tas2r120 A T 6: 132,634,572 (GRCm39) Q218L probably benign Het
Trim24 A G 6: 37,935,612 (GRCm39) T868A probably benign Het
Ttn T A 2: 76,598,684 (GRCm39) M19410L possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Upb1 G A 10: 75,272,051 (GRCm39) R288H probably damaging Het
Wdr20rt T A 12: 65,273,007 (GRCm39) W56R probably damaging Het
Wdr62 T G 7: 29,967,328 (GRCm39) I309L probably damaging Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp40 T C 17: 23,397,344 (GRCm39) D51G possibly damaging Het
Zfp64 G A 2: 168,768,662 (GRCm39) H317Y probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTACTGGTCTCATGCCATC -3'
(R):5'- GCATGAAGGTTTCAGAGGGC -3'

Sequencing Primer
(F):5'- ACTGGTCTCATGCCATCCCTATC -3'
(R):5'- TCAGCCCTGGATAGCTCTGTAAG -3'
Posted On 2014-10-16