Mutagenetix > Incidental Mutation

Incidental Mutation 'R2254:Ano9'

241878

Institutional Source

Beutler Lab

Gene Symbol

Ano9

Ensembl Gene

ENSMUSG00000054662

Gene Name

anoctamin 9

Synonyms

5430425C04Rik, Tmem16j, Trp53i5, Tp53i5

MMRRC Submission

040254-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R2254 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141101212-141117806 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141103090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 635 (D635V)

Ref Sequence

ENSEMBL: ENSMUSP00000067689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067836] [ENSMUST00000097958] [ENSMUST00000209294] [ENSMUST00000210167]

AlphaFold

P86044

Predicted Effect

probably benign
Transcript: ENSMUST00000067836
AA Change: D635V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: D635V

Domain	Start	End	E-Value	Type
Pfam:Anoctamin	174	730	3.3e-118	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097958

SMART Domains

Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

Domain	Start	End	E-Value	Type
IG	17	112	5.21e-2	SMART
transmembrane domain	117	139	N/A	INTRINSIC
Pfam:TIR	163	327	2.2e-19	PFAM
Pfam:TIR_2	166	308	2.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157917

Predicted Effect

probably benign
Transcript: ENSMUST00000209294

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210085

Predicted Effect

probably benign
Transcript: ENSMUST00000210167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210496

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210927

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210978

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211515

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	G	T	7: 131,222,905	C243F	probably damaging	Het
Actn2	T	C	13: 12,296,479	E260G	probably benign	Het
AI429214	G	T	8: 36,993,766	D23Y	possibly damaging	Het
Alms1	A	G	6: 85,619,848	Y1021C	probably damaging	Het
Ang5	A	G	14: 43,962,617	D46G	probably benign	Het
Apob	C	T	12: 8,011,256	T3246I	possibly damaging	Het
Arhgef25	T	C	10: 127,189,521	E63G	probably benign	Het
B3gnt4	A	C	5: 123,511,279	I236L	probably damaging	Het
Bmper	T	A	9: 23,381,463	I356N	possibly damaging	Het
Capn3	A	G	2: 120,501,251	E614G	probably benign	Het
Ccdc90b	T	A	7: 92,572,568	H118Q	probably damaging	Het
Cdh2	A	T	18: 16,643,928		probably null	Het
Chmp7	C	T	14: 69,720,956	V255I	probably damaging	Het
Dnhd1	T	A	7: 105,703,772	S2711T	probably damaging	Het
Gabrg1	T	A	5: 70,782,364	K137*	probably null	Het
Gdi2	T	A	13: 3,554,400		probably null	Het
Glyr1	A	G	16: 5,019,013	V429A	probably benign	Het
Gm5938	T	A	X: 78,128,555		probably null	Het
Golt1b	T	C	6: 142,396,253	L121P	probably damaging	Het
Gpi1	T	C	7: 34,202,877	N471S	probably damaging	Het
Ifi204	G	A	1: 173,761,730	T45M	possibly damaging	Het
Il18r1	A	G	1: 40,491,220	N369S	possibly damaging	Het
Kcnh1	G	T	1: 192,505,414		probably null	Het
Kitl	G	A	10: 100,080,131		probably null	Het
Krt33a	A	T	11: 100,014,178	D167E	possibly damaging	Het
Lax1	A	G	1: 133,680,233	S257P	probably damaging	Het
Lepr	T	C	4: 101,815,112	I1111T	probably benign	Het
Lrrcc1	G	A	3: 14,547,255	R356H	probably damaging	Het
Map1a	A	G	2: 121,303,791	D1458G	possibly damaging	Het
Med11	T	C	11: 70,452,095		probably null	Het
Mtmr2	T	C	9: 13,796,057	Y230H	possibly damaging	Het
Nup93	T	C	8: 94,227,857		probably null	Het
Olfr610	A	G	7: 103,506,064	V294A	probably damaging	Het
Ovch2	A	G	7: 107,790,195	V342A	probably benign	Het
Ovgp1	A	G	3: 105,986,912		probably benign	Het
Oxtr	A	T	6: 112,489,106	L231Q	probably damaging	Het
Prap1	A	G	7: 140,096,162	T30A	probably damaging	Het
Scg2	G	A	1: 79,436,500	P169S	probably damaging	Het
Scube2	A	G	7: 109,825,459	V549A	possibly damaging	Het
Slc22a12	A	T	19: 6,542,541	V57D	possibly damaging	Het
Slc22a28	A	C	19: 8,064,493	C450G	probably benign	Het
Tas2r120	A	T	6: 132,657,609	Q218L	probably benign	Het
Tbx15	A	G	3: 99,351,874	T354A	possibly damaging	Het
Trim24	A	G	6: 37,958,677	T868A	probably benign	Het
Ttn	T	A	2: 76,768,340	M19410L	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Upb1	G	A	10: 75,436,217	R288H	probably damaging	Het
Wdr20rt	T	A	12: 65,226,233	W56R	probably damaging	Het
Wdr62	T	G	7: 30,267,903	I309L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp40	T	C	17: 23,178,370	D51G	possibly damaging	Het
Zfp64	G	A	2: 168,926,742	H317Y	probably damaging	Het

Other mutations in Ano9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ano9	APN	7	141102042	nonsense	probably null
IGL01620:Ano9	APN	7	141110439	missense	probably damaging	1.00
IGL02045:Ano9	APN	7	141102469	missense	probably benign	0.00
IGL02506:Ano9	APN	7	141102254	unclassified	probably benign
IGL02657:Ano9	APN	7	141107440	missense	probably damaging	1.00
IGL02731:Ano9	APN	7	141107204	missense	probably damaging	1.00
IGL02863:Ano9	APN	7	141108651	missense	probably benign	0.00
R0114:Ano9	UTSW	7	141103239	unclassified	probably benign
R0374:Ano9	UTSW	7	141107814	missense	probably damaging	0.98
R0487:Ano9	UTSW	7	141107849	missense	possibly damaging	0.85
R0600:Ano9	UTSW	7	141104710	missense	probably damaging	1.00
R0702:Ano9	UTSW	7	141107282	missense	probably damaging	1.00
R0765:Ano9	UTSW	7	141107184	missense	probably damaging	1.00
R1679:Ano9	UTSW	7	141108297	missense	probably benign	0.03
R1773:Ano9	UTSW	7	141108378	missense	possibly damaging	0.95
R1809:Ano9	UTSW	7	141108804	missense	possibly damaging	0.93
R1883:Ano9	UTSW	7	141102331	missense	probably benign
R2034:Ano9	UTSW	7	141108135	missense	probably damaging	0.99
R2159:Ano9	UTSW	7	141108117	missense	probably benign	0.01
R2293:Ano9	UTSW	7	141102515	missense	probably benign
R3177:Ano9	UTSW	7	141104124	missense	probably damaging	1.00
R3277:Ano9	UTSW	7	141104124	missense	probably damaging	1.00
R4274:Ano9	UTSW	7	141110695	missense	probably benign
R4576:Ano9	UTSW	7	141104138	missense	probably damaging	1.00
R4577:Ano9	UTSW	7	141104138	missense	probably damaging	1.00
R4872:Ano9	UTSW	7	141107204	missense	probably damaging	1.00
R4879:Ano9	UTSW	7	141110502	missense	probably benign	0.23
R5160:Ano9	UTSW	7	141104365	missense	probably damaging	1.00
R5560:Ano9	UTSW	7	141110482	missense	probably damaging	1.00
R6148:Ano9	UTSW	7	141106785	missense	probably damaging	1.00
R6302:Ano9	UTSW	7	141104308	missense	probably damaging	1.00
R6821:Ano9	UTSW	7	141107256	missense	possibly damaging	0.70
R7253:Ano9	UTSW	7	141107437	missense	probably damaging	0.96
R7479:Ano9	UTSW	7	141102435	missense	probably damaging	0.99
R7836:Ano9	UTSW	7	141103201	missense	probably damaging	1.00
R7942:Ano9	UTSW	7	141104076	missense	probably damaging	0.96
R8051:Ano9	UTSW	7	141104532	missense	probably damaging	1.00
R8341:Ano9	UTSW	7	141102334	missense	possibly damaging	0.94
R8690:Ano9	UTSW	7	141104307	missense	probably benign	0.26
R9137:Ano9	UTSW	7	141104115	missense	probably damaging	1.00
R9355:Ano9	UTSW	7	141101904	missense	probably benign	0.00
R9521:Ano9	UTSW	7	141102314	missense	probably benign	0.01
R9645:Ano9	UTSW	7	141107475	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- AAGGGTCCATCAGTTATTCCC -3'
(R):5'- GCTCCAAGCTTTTAGGGCAG -3'

Sequencing Primer
(F):5'- AGGGTCCATCAGTTATTCCCAGAATC -3'
(R):5'- CTACCAATGATCAGGACTGGCTG -3'

Posted On

2014-10-16