Mutagenetix > Incidental Mutations

Incidental Mutation 'R0166:Llgl2'

24188

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

038442-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R0166 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115844854 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 92 (L92P)

Ref Sequence

ENSEMBL: ENSMUSP00000133790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000172552] [ENSMUST00000173289] [ENSMUST00000177736]

Predicted Effect

probably damaging
Transcript: ENSMUST00000103032
AA Change: L92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000133250
AA Change: L92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	146	1e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000137900
AA Change: L92P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	3e-20	BLAST
SCOP:d1gxra_	19	158	7e-9	SMART
Blast:WD40	62	101	6e-22	BLAST
Blast:WD40	112	157	2e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000155878
AA Change: L92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	1e-20	BLAST
SCOP:d1gxra_	19	118	3e-8	SMART
Blast:WD40	62	101	3e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000172552
AA Change: L92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133803
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	4e-21	BLAST
SCOP:d1gxra_	19	101	1e-7	SMART
Blast:WD40	62	101	2e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000173289
AA Change: L92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	148	4e-17	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000177736
AA Change: L92P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: L92P

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Meta Mutation Damage Score

0.9071

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 91.4%

Validation Efficiency

91% (49/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	C	5: 8,853,468	F1040L	probably damaging	Het
Adamts7	A	G	9: 90,193,692	N1201S	probably benign	Het
Ahnak	C	T	19: 9,005,725	P1458S	probably damaging	Het
Akap6	T	C	12: 53,140,924	V1707A	probably benign	Het
Akr1c21	T	A	13: 4,581,264	V266E	probably damaging	Het
Arap2	A	C	5: 62,676,018	C894G	probably damaging	Het
Atp2a2	T	C	5: 122,466,838	D426G	possibly damaging	Het
Azi2	A	T	9: 118,055,841	Q132L	possibly damaging	Het
Carmil1	C	T	13: 24,099,049	D91N	probably damaging	Het
Cnot7	A	T	8: 40,507,453		probably null	Het
Cntnap5b	A	G	1: 100,274,361	E311G	probably benign	Het
Csmd1	A	G	8: 16,233,022	V640A	probably benign	Het
Cst7	T	C	2: 150,575,727	S31P	probably benign	Het
Cyp7b1	T	A	3: 18,097,366	I228L	probably benign	Het
Ddx28	G	A	8: 106,010,289	T379I	probably benign	Het
Dirc2	G	A	16: 35,719,314	T379I	possibly damaging	Het
Drd1	T	A	13: 54,053,581	I205F	probably damaging	Het
Flnb	T	A	14: 7,896,115	V837D	probably damaging	Het
Fsd1l	A	G	4: 53,647,664		probably null	Het
Fubp1	T	A	3: 152,220,204	Y264*	probably null	Het
Gbp5	T	A	3: 142,506,919		probably null	Het
Gm13088	T	A	4: 143,654,511	H314L	probably benign	Het
Gm7094	A	G	1: 21,272,734		noncoding transcript	Het
Gpr55	A	G	1: 85,941,136	V241A	probably benign	Het
Impa1	C	T	3: 10,328,960	A16T	probably damaging	Het
Ltbp2	T	A	12: 84,786,358	Q1472L	probably benign	Het
Lyplal1	A	T	1: 186,088,746	M168K	probably benign	Het
Macc1	A	T	12: 119,447,080	R528*	probably null	Het
Mdm1	T	A	10: 118,166,680	D635E	probably damaging	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mrpl23	C	T	7: 142,535,114	R69W	probably damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nr0b2	A	G	4: 133,553,738	Q105R	probably damaging	Het
Olfr920	T	A	9: 38,756,188	S167T	probably benign	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Pcdhb14	A	T	18: 37,448,489		probably null	Het
Plxna1	A	G	6: 89,333,019	W1055R	probably damaging	Het
Prdm1	C	T	10: 44,440,091	R716Q	probably damaging	Het
Proser1	C	A	3: 53,480,617	Q909K	possibly damaging	Het
Pus10	T	A	11: 23,667,358	C24S	probably damaging	Het
Rpl27	T	A	11: 101,445,320	F69I	possibly damaging	Het
Sctr	A	T	1: 120,055,394	I325F	probably damaging	Het
Slc5a3	G	A	16: 92,077,693	V213I	possibly damaging	Het
Spib	G	T	7: 44,529,900	D28E	probably damaging	Het
Spic	T	C	10: 88,675,717	S226G	possibly damaging	Het
Tet1	T	A	10: 62,840,279	T673S	probably benign	Het
Tph1	A	G	7: 46,647,596	F392L	probably damaging	Het
Ttc28	T	C	5: 111,225,634	S979P	probably benign	Het
Unc79	T	C	12: 103,156,553	L2110P	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Zfp467	T	C	6: 48,438,681	T346A	probably benign	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGAACCACAGAGAGCCTTTTGTCC -3'
(R):5'- TTCCAGAGCACGAGATGGTGGTAG -3'

Sequencing Primer
(F):5'- TCTGTAGCTAGCAAGCTCCT -3'
(R):5'- ACACTGAGTTAGGCACTGC -3'

Posted On

2013-04-16