Incidental Mutation 'R2255:Stk17b'
ID 241906
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission 040255-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2255 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 53794671-53824374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53815731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 23 (I23V)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect probably benign
Transcript: ENSMUST00000027263
AA Change: I23V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: I23V

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,616,561 (GRCm39) T1210I probably benign Het
Agbl1 T C 7: 76,071,932 (GRCm39) F581S probably damaging Het
Ambra1 A T 2: 91,747,806 (GRCm39) N1061Y probably damaging Het
Aoc1l1 G A 6: 48,952,891 (GRCm39) R272H possibly damaging Het
Arl6ip5 T C 6: 97,209,361 (GRCm39) L132S probably damaging Het
Atp10b G A 11: 43,125,207 (GRCm39) V1058I probably damaging Het
B3gnt4 A C 5: 123,649,342 (GRCm39) I236L probably damaging Het
Bmper T A 9: 23,292,759 (GRCm39) I356N possibly damaging Het
Bpifa6 T A 2: 153,832,815 (GRCm39) I310N probably damaging Het
Btnl9 A T 11: 49,060,143 (GRCm39) L535* probably null Het
Capn3 A G 2: 120,331,732 (GRCm39) E614G probably benign Het
Catip T C 1: 74,408,159 (GRCm39) probably benign Het
Ccdc180 T A 4: 45,921,996 (GRCm39) S1023R probably damaging Het
Ces2g G A 8: 105,694,046 (GRCm39) E461K probably damaging Het
Chad C A 11: 94,456,523 (GRCm39) H200Q possibly damaging Het
Crbn C T 6: 106,772,159 (GRCm39) probably null Het
Crip3 G C 17: 46,740,298 (GRCm39) E33Q probably damaging Het
D130043K22Rik A T 13: 25,040,894 (GRCm39) R105S probably damaging Het
Dmxl1 C T 18: 49,979,706 (GRCm39) H114Y probably benign Het
Dpp3 T C 19: 4,968,347 (GRCm39) N242D probably benign Het
Dtx3l T C 16: 35,756,949 (GRCm39) N78S probably benign Het
Dync2h1 A G 9: 6,955,905 (GRCm39) probably null Het
Esrp1 A G 4: 11,365,211 (GRCm39) V260A probably damaging Het
Etfdh A G 3: 79,511,349 (GRCm39) V544A probably benign Het
Ezhip T G X: 5,994,754 (GRCm39) E87A probably benign Het
Fcgr1 G T 3: 96,193,233 (GRCm39) H255N possibly damaging Het
Fcrl2 G T 3: 87,164,655 (GRCm39) Y290* probably null Het
Frem2 A G 3: 53,559,935 (GRCm39) V1524A probably damaging Het
Gabbr1 T C 17: 37,382,758 (GRCm39) I817T probably damaging Het
Gapdhs G C 7: 30,429,333 (GRCm39) probably null Het
Gm57858 A G 3: 36,074,099 (GRCm39) V350A probably benign Het
Gopc A T 10: 52,225,181 (GRCm39) I356K probably damaging Het
Gpi1 T C 7: 33,902,302 (GRCm39) N471S probably damaging Het
Gpr171 A G 3: 59,005,628 (GRCm39) V49A probably benign Het
Greb1l T A 18: 10,554,857 (GRCm39) N1634K probably damaging Het
Gria1 G A 11: 57,076,775 (GRCm39) R57H probably damaging Het
Herpud1 A G 8: 95,121,241 (GRCm39) E344G probably benign Het
Hhip A G 8: 80,771,810 (GRCm39) F167L probably damaging Het
Hp1bp3 T A 4: 137,953,209 (GRCm39) D84E probably damaging Het
Ier3 A G 17: 36,133,153 (GRCm39) Y145C probably damaging Het
Ifi47 A T 11: 48,987,474 (GRCm39) I414L probably benign Het
Ifnl2 C T 7: 28,209,638 (GRCm39) A50T possibly damaging Het
Jade1 A G 3: 41,546,185 (GRCm39) Y70C probably damaging Het
Kif1b A T 4: 149,359,454 (GRCm39) F94L probably damaging Het
Krt33a A T 11: 99,905,004 (GRCm39) D167E possibly damaging Het
Map1a A G 2: 121,134,272 (GRCm39) D1458G possibly damaging Het
Mrgpra4 A G 7: 47,631,523 (GRCm39) L26S possibly damaging Het
Mtmr2 T C 9: 13,707,353 (GRCm39) Y230H possibly damaging Het
Nae1 T A 8: 105,256,700 (GRCm39) D69V probably damaging Het
Nbr1 T A 11: 101,463,643 (GRCm39) V625E possibly damaging Het
Nek1 T C 8: 61,542,807 (GRCm39) L702P probably damaging Het
Ntf3 T C 6: 126,078,689 (GRCm39) *272W probably null Het
Ofcc1 A C 13: 40,248,181 (GRCm39) L651R probably damaging Het
Olfm3 A T 3: 114,915,842 (GRCm39) probably null Het
Pcdhb19 C T 18: 37,630,997 (GRCm39) A264V probably benign Het
Pear1 C A 3: 87,659,493 (GRCm39) W780C probably damaging Het
Pkhd1 T A 1: 20,635,863 (GRCm39) H489L probably benign Het
Pros1 T A 16: 62,723,935 (GRCm39) C228S possibly damaging Het
Rbm10 G A X: 20,501,978 (GRCm39) R9H unknown Het
Rwdd1 T C 10: 33,878,466 (GRCm39) E123G probably damaging Het
Slc22a2 G T 17: 12,818,062 (GRCm39) V213F probably damaging Het
Slc34a1 T C 13: 24,004,991 (GRCm39) I412T probably benign Het
Smarca2 A T 19: 26,748,438 (GRCm39) I98L probably benign Het
Spag6l T C 16: 16,595,203 (GRCm39) E394G probably damaging Het
Spdef T C 17: 27,939,269 (GRCm39) T26A probably benign Het
Sult2a7 A G 7: 14,225,818 (GRCm39) I56T probably damaging Het
Tango6 T A 8: 107,415,926 (GRCm39) probably null Het
Tex46 T C 4: 136,337,844 (GRCm39) L12P possibly damaging Het
Ttn T A 2: 76,598,684 (GRCm39) M19410L possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Unc5cl T A 17: 48,766,974 (GRCm39) I116N possibly damaging Het
Unc80 A T 1: 66,657,417 (GRCm39) I1630F possibly damaging Het
Upb1 G A 10: 75,272,051 (GRCm39) R288H probably damaging Het
Wdr62 T G 7: 29,967,328 (GRCm39) I309L probably damaging Het
Whrn C T 4: 63,336,385 (GRCm39) V295M possibly damaging Het
Wrn G A 8: 33,819,230 (GRCm39) P241S probably benign Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp687 A T 3: 94,917,748 (GRCm39) C675S probably damaging Het
Zfp954 A G 7: 7,118,321 (GRCm39) Y408H possibly damaging Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53,803,299 (GRCm39) missense probably damaging 0.99
IGL00767:Stk17b APN 1 53,803,182 (GRCm39) splice site probably benign
IGL01012:Stk17b APN 1 53,800,196 (GRCm39) missense probably benign 0.06
IGL01431:Stk17b APN 1 53,805,074 (GRCm39) splice site probably benign
IGL01914:Stk17b APN 1 53,800,226 (GRCm39) missense probably damaging 0.98
IGL02236:Stk17b APN 1 53,803,247 (GRCm39) missense probably damaging 1.00
IGL02827:Stk17b APN 1 53,815,701 (GRCm39) missense probably benign 0.03
R0013:Stk17b UTSW 1 53,803,291 (GRCm39) missense probably benign 0.36
R0545:Stk17b UTSW 1 53,801,742 (GRCm39) splice site probably benign
R0831:Stk17b UTSW 1 53,796,651 (GRCm39) missense probably damaging 1.00
R1035:Stk17b UTSW 1 53,801,758 (GRCm39) missense probably benign 0.22
R1375:Stk17b UTSW 1 53,805,106 (GRCm39) missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53,796,749 (GRCm39) missense probably damaging 1.00
R1809:Stk17b UTSW 1 53,805,140 (GRCm39) missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53,800,241 (GRCm39) missense probably damaging 1.00
R2033:Stk17b UTSW 1 53,800,235 (GRCm39) missense probably damaging 1.00
R2105:Stk17b UTSW 1 53,815,764 (GRCm39) missense probably benign 0.01
R4395:Stk17b UTSW 1 53,803,274 (GRCm39) missense probably damaging 0.98
R4521:Stk17b UTSW 1 53,803,197 (GRCm39) missense probably damaging 1.00
R4777:Stk17b UTSW 1 53,810,867 (GRCm39) missense probably damaging 1.00
R4871:Stk17b UTSW 1 53,796,693 (GRCm39) missense probably benign 0.14
R4892:Stk17b UTSW 1 53,810,770 (GRCm39) missense probably damaging 0.99
R4999:Stk17b UTSW 1 53,800,306 (GRCm39) splice site probably null
R5122:Stk17b UTSW 1 53,815,717 (GRCm39) missense probably damaging 1.00
R5621:Stk17b UTSW 1 53,810,943 (GRCm39) nonsense probably null
R6636:Stk17b UTSW 1 53,800,247 (GRCm39) missense probably damaging 1.00
R6924:Stk17b UTSW 1 53,800,218 (GRCm39) missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53,796,674 (GRCm39) missense probably benign
R7322:Stk17b UTSW 1 53,805,104 (GRCm39) missense probably benign 0.16
R7671:Stk17b UTSW 1 53,805,159 (GRCm39) missense probably damaging 0.99
R8984:Stk17b UTSW 1 53,796,784 (GRCm39) missense probably benign 0.05
R9476:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
R9510:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATATTTGATATGAACTCCTCCAC -3'
(R):5'- GTAATGCACATCCTGCCTGAG -3'

Sequencing Primer
(F):5'- TGAACTCCTCCACAGATTTAATTTTC -3'
(R):5'- TGCACATCCTGCCTGAGATAATG -3'
Posted On 2014-10-16