Incidental Mutation 'R2255:Zfp687'
ID 241927
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Name zinc finger protein 687
Synonyms 4931408L03Rik
MMRRC Submission 040255-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock # R2255 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 95006590-95015448 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95010437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 675 (C675S)
Ref Sequence ENSEMBL: ENSMUSP00000123335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000133297] [ENSMUST00000137799] [ENSMUST00000149747] [ENSMUST00000167008]
AlphaFold Q9D2D7
Predicted Effect probably damaging
Transcript: ENSMUST00000019482
AA Change: C675S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338
AA Change: C675S

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126222
Predicted Effect probably benign
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133166
Predicted Effect probably benign
Transcript: ENSMUST00000133297
SMART Domains Protein: ENSMUSP00000123529
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 1 225 7.13e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137799
AA Change: C675S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338
AA Change: C675S

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147022
Predicted Effect probably benign
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4424:Zfp687 UTSW 3 95009128 missense probably damaging 1.00
R4630:Zfp687 UTSW 3 95012488 splice site probably null
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5732:Zfp687 UTSW 3 95011217 missense possibly damaging 0.50
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6463:Zfp687 UTSW 3 95010784 missense probably damaging 1.00
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R6973:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
R7407:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7408:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7483:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7492:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7514:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7849:Zfp687 UTSW 3 95010362 missense possibly damaging 0.65
R8438:Zfp687 UTSW 3 95008122 missense probably benign 0.10
R9542:Zfp687 UTSW 3 95009131 missense probably damaging 1.00
Z1176:Zfp687 UTSW 3 95007701 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCAAGAGGTTAAACAAGGTC -3'
(R):5'- AGACATCACACCCTTGCTGC -3'

Sequencing Primer
(F):5'- TCAATTAATGAGGGGTGCCC -3'
(R):5'- ACACCCTTGCTGCCTGTGG -3'
Posted On 2014-10-16