Mutagenetix > Incidental Mutations

Incidental Mutation 'R2255:Fcgr1'

241928

Institutional Source

Beutler Lab

Gene Symbol

Fcgr1

Ensembl Gene

ENSMUSG00000015947

Gene Name

Fc receptor, IgG, high affinity I

Synonyms

CD64, FcgammaRI

MMRRC Submission

040255-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.449) question?

Stock #

R2255 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96282909-96293969 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 96285917 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 255 (H255N)

Ref Sequence

ENSEMBL: ENSMUSP00000029748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029748]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029748
AA Change: H255N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: H255N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	38	111	1.8e-5	SMART
IGc2	125	184	6.11e-8	SMART
IG	206	290	7.3e-6	SMART
transmembrane domain	298	320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200420

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	G	A	17: 46,305,635	T1210I	probably benign	Het
Agbl1	T	C	7: 76,422,184	F581S	probably damaging	Het
Ambra1	A	T	2: 91,917,461	N1061Y	probably damaging	Het
Arl6ip5	T	C	6: 97,232,400	L132S	probably damaging	Het
Atp10b	G	A	11: 43,234,380	V1058I	probably damaging	Het
AU022751	T	G	X: 6,082,700	E87A	probably benign	Het
B3gnt4	A	C	5: 123,511,279	I236L	probably damaging	Het
Bmper	T	A	9: 23,381,463	I356N	possibly damaging	Het
Bpifa6	T	A	2: 153,990,895	I310N	probably damaging	Het
Btnl9	A	T	11: 49,169,316	L535*	probably null	Het
Capn3	A	G	2: 120,501,251	E614G	probably benign	Het
Catip	T	C	1: 74,369,000		probably benign	Het
Ccdc144b	A	G	3: 36,019,950	V350A	probably benign	Het
Ccdc180	T	A	4: 45,921,996	S1023R	probably damaging	Het
Ces2g	G	A	8: 104,967,414	E461K	probably damaging	Het
Chad	C	A	11: 94,565,697	H200Q	possibly damaging	Het
Crbn	C	T	6: 106,795,198		probably null	Het
Crip3	G	C	17: 46,429,372	E33Q	probably damaging	Het
D130043K22Rik	A	T	13: 24,856,911	R105S	probably damaging	Het
Dmxl1	C	T	18: 49,846,639	H114Y	probably benign	Het
Doxl2	G	A	6: 48,975,957	R272H	possibly damaging	Het
Dpp3	T	C	19: 4,918,319	N242D	probably benign	Het
Dtx3l	T	C	16: 35,936,579	N78S	probably benign	Het
Dync2h1	A	G	9: 6,955,905		probably null	Het
Esrp1	A	G	4: 11,365,211	V260A	probably damaging	Het
Etfdh	A	G	3: 79,604,042	V544A	probably benign	Het
Fcrls	G	T	3: 87,257,348	Y290*	probably null	Het
Frem2	A	G	3: 53,652,514	V1524A	probably damaging	Het
Gabbr1	T	C	17: 37,071,866	I817T	probably damaging	Het
Gapdhs	G	C	7: 30,729,908		probably null	Het
Gopc	A	T	10: 52,349,085	I356K	probably damaging	Het
Gpi1	T	C	7: 34,202,877	N471S	probably damaging	Het
Gpr171	A	G	3: 59,098,207	V49A	probably benign	Het
Greb1l	T	A	18: 10,554,857	N1634K	probably damaging	Het
Gria1	G	A	11: 57,185,949	R57H	probably damaging	Het
Herpud1	A	G	8: 94,394,613	E344G	probably benign	Het
Hhip	A	G	8: 80,045,181	F167L	probably damaging	Het
Hp1bp3	T	A	4: 138,225,898	D84E	probably damaging	Het
Ier3	A	G	17: 35,822,261	Y145C	probably damaging	Het
Ifi47	A	T	11: 49,096,647	I414L	probably benign	Het
Ifnl2	C	T	7: 28,510,213	A50T	possibly damaging	Het
Jade1	A	G	3: 41,591,750	Y70C	probably damaging	Het
Kif1b	A	T	4: 149,274,997	F94L	probably damaging	Het
Krt33a	A	T	11: 100,014,178	D167E	possibly damaging	Het
Map1a	A	G	2: 121,303,791	D1458G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,775	L26S	possibly damaging	Het
Mtmr2	T	C	9: 13,796,057	Y230H	possibly damaging	Het
Nae1	T	A	8: 104,530,068	D69V	probably damaging	Het
Nbr1	T	A	11: 101,572,817	V625E	possibly damaging	Het
Nek1	T	C	8: 61,089,773	L702P	probably damaging	Het
Ntf3	T	C	6: 126,101,726	*272W	probably null	Het
Ofcc1	A	C	13: 40,094,705	L651R	probably damaging	Het
Olfm3	A	T	3: 115,122,193		probably null	Het
Pcdhb19	C	T	18: 37,497,944	A264V	probably benign	Het
Pear1	C	A	3: 87,752,186	W780C	probably damaging	Het
Pkhd1	T	A	1: 20,565,639	H489L	probably benign	Het
Pros1	T	A	16: 62,903,572	C228S	possibly damaging	Het
Rbm10	G	A	X: 20,635,739	R9H	unknown	Het
Rwdd1	T	C	10: 34,002,470	E123G	probably damaging	Het
Slc17a2	T	C	13: 23,821,008	I412T	probably benign	Het
Slc22a2	G	T	17: 12,599,175	V213F	probably damaging	Het
Smarca2	A	T	19: 26,771,038	I98L	probably benign	Het
Spag6l	T	C	16: 16,777,339	E394G	probably damaging	Het
Spdef	T	C	17: 27,720,295	T26A	probably benign	Het
Stk17b	T	C	1: 53,776,572	I23V	probably benign	Het
Sult2a7	A	G	7: 14,491,893	I56T	probably damaging	Het
Tango6	T	A	8: 106,689,294		probably null	Het
Tex46	T	C	4: 136,610,533	L12P	possibly damaging	Het
Ttn	T	A	2: 76,768,340	M19410L	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc5cl	T	A	17: 48,459,946	I116N	possibly damaging	Het
Unc80	A	T	1: 66,618,258	I1630F	possibly damaging	Het
Upb1	G	A	10: 75,436,217	R288H	probably damaging	Het
Wdr62	T	G	7: 30,267,903	I309L	probably damaging	Het
Whrn	C	T	4: 63,418,148	V295M	possibly damaging	Het
Wrn	G	A	8: 33,329,202	P241S	probably benign	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp687	A	T	3: 95,010,437	C675S	probably damaging	Het
Zfp954	A	G	7: 7,115,322	Y408H	possibly damaging	Het

Other mutations in Fcgr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01490:Fcgr1	APN	3	96284370	missense	probably benign	0.01
IGL02142:Fcgr1	APN	3	96284577	missense	probably benign	0.41
IGL03086:Fcgr1	APN	3	96284498	nonsense	probably null
F5770:Fcgr1	UTSW	3	96284276	makesense	probably null
FR4737:Fcgr1	UTSW	3	96284504	frame shift	probably null
FR4737:Fcgr1	UTSW	3	96287094	missense	probably benign	0.01
R0323:Fcgr1	UTSW	3	96285829	missense	possibly damaging	0.84
R0594:Fcgr1	UTSW	3	96292312	missense	probably damaging	1.00
R0926:Fcgr1	UTSW	3	96292366	missense	possibly damaging	0.79
R1951:Fcgr1	UTSW	3	96287070	missense	probably damaging	1.00
R1953:Fcgr1	UTSW	3	96287070	missense	probably damaging	1.00
R1993:Fcgr1	UTSW	3	96285868	missense	probably damaging	0.98
R3941:Fcgr1	UTSW	3	96286033	missense	probably benign	0.13
R4004:Fcgr1	UTSW	3	96284352	missense	probably benign	0.00
R4409:Fcgr1	UTSW	3	96284577	missense	probably benign	0.41
R5046:Fcgr1	UTSW	3	96286986	missense	probably damaging	0.99
R5047:Fcgr1	UTSW	3	96285884	missense	probably benign	0.38
R6970:Fcgr1	UTSW	3	96284620	critical splice acceptor site	probably null
R7339:Fcgr1	UTSW	3	96284299	missense	not run
R7939:Fcgr1	UTSW	3	96284627	splice site	probably null
V7581:Fcgr1	UTSW	3	96284276	makesense	probably null
V7582:Fcgr1	UTSW	3	96284276	makesense	probably null
V7583:Fcgr1	UTSW	3	96284276	makesense	probably null
X0028:Fcgr1	UTSW	3	96286027	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- AGTGTTCCTCTTCCAGGCTG -3'
(R):5'- ACAGAGTGAATACCCTGTCCC -3'

Sequencing Primer
(F):5'- TGGACTACAAACCCCTGAGTGAG -3'
(R):5'- TTTAGAGCTGTTTACCACGCCAG -3'

Posted On

2014-10-16