Incidental Mutation 'R2255:Gapdhs'
ID241946
Institutional Source Beutler Lab
Gene Symbol Gapdhs
Ensembl Gene ENSMUSG00000061099
Gene Nameglyceraldehyde-3-phosphate dehydrogenase, spermatogenic
SynonymsGapd-s, Gapds
MMRRC Submission 040255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R2255 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30729775-30743681 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 30729908 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000074758] [ENSMUST00000170371] [ENSMUST00000182067] [ENSMUST00000182634] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000207779] [ENSMUST00000208169] [ENSMUST00000209065]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000006478
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074758
AA Change: Y432*
SMART Domains Protein: ENSMUSP00000074317
Gene: ENSMUSG00000061099
AA Change: Y432*

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Gp_dh_N 106 254 6.13e-79 SMART
Pfam:Gp_dh_C 259 416 2.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect probably benign
Transcript: ENSMUST00000170371
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180820
SMART Domains Protein: ENSMUSP00000137757
Gene: ENSMUSG00000097320

DomainStartEndE-ValueType
SCOP:d1i7oa2 53 93 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182067
SMART Domains Protein: ENSMUSP00000138697
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
PDB:2VYV|D 1 44 3e-15 PDB
Blast:Gp_dh_N 4 33 9e-7 BLAST
SCOP:d1cf2o2 9 45 3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182488
Predicted Effect probably null
Transcript: ENSMUST00000182634
AA Change: Y434*
SMART Domains Protein: ENSMUSP00000138634
Gene: ENSMUSG00000061099
AA Change: Y434*

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
Gp_dh_N 108 256 6.13e-79 SMART
Pfam:Gp_dh_C 261 418 4.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183194
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably null
Transcript: ENSMUST00000207296
Predicted Effect probably benign
Transcript: ENSMUST00000207779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207955
Predicted Effect probably null
Transcript: ENSMUST00000208169
Predicted Effect probably null
Transcript: ENSMUST00000209065
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the glyceraldehyde-3-phosphate dehydrogenase family of enzymes that play an important role in carbohydrate metabolism. Like its somatic cell counterpart, this sperm-specific enzyme functions in a nicotinamide adenine dinucleotide-dependent manner to remove hydrogen and add phosphate to glyceraldehyde 3-phosphate to form 1,3-diphosphoglycerate. During spermiogenesis, this enzyme may play an important role in regulating the switch between different energy-producing pathways, and it is required for sperm motility and male fertility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Gapdhs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Gapdhs APN 7 30730441 unclassified probably benign
IGL01667:Gapdhs APN 7 30736637 missense possibly damaging 0.90
IGL02860:Gapdhs APN 7 30729883 splice site probably null
IGL02878:Gapdhs APN 7 30729879 unclassified probably benign
IGL03372:Gapdhs APN 7 30733249 unclassified probably benign
R1662:Gapdhs UTSW 7 30737002 missense probably damaging 1.00
R4941:Gapdhs UTSW 7 30733266 missense probably benign 0.02
R5059:Gapdhs UTSW 7 30731985 missense probably benign 0.17
R5877:Gapdhs UTSW 7 30732347 missense probably damaging 1.00
R7571:Gapdhs UTSW 7 30737958 missense unknown
R7622:Gapdhs UTSW 7 30739331 missense unknown
R7714:Gapdhs UTSW 7 30731924 missense probably damaging 1.00
R7902:Gapdhs UTSW 7 30736721 missense probably damaging 1.00
R8410:Gapdhs UTSW 7 30737910 missense unknown
R8954:Gapdhs UTSW 7 30733166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAGAACTTTGAACCCCG -3'
(R):5'- ACTTCGTGAAGCTTGTTGCC -3'

Sequencing Primer
(F):5'- GCCCTGAACGCAAGGTGATC -3'
(R):5'- GAAGCTTGTTGCCTGGTAAAG -3'
Posted On2014-10-16