Incidental Mutation 'R2255:Gpi1'
ID241947
Institutional Source Beutler Lab
Gene Symbol Gpi1
Ensembl Gene ENSMUSG00000036427
Gene Nameglucose phosphate isomerase 1
Synonymsneuroleukin, MF, Gpi-1t, Gpi-1s, Gpi-1r, maturation factor, Org, NK, NK/GPI, Gpi-1, AMF, Gpi1-t, Gpi1-s, Gpi1-r, autocrine motility factor
MMRRC Submission 040255-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2255 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34201330-34230336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34202877 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 471 (N471S)
Ref Sequence ENSEMBL: ENSMUSP00000049355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038027] [ENSMUST00000205870] [ENSMUST00000205983] [ENSMUST00000206415]
PDB Structure
Crystal structure of mouse phosphoglucose isomerase [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with glucose 6-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with erythrose 4-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse AMF [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / phosphate complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / E4P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / A5P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / S6P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / 6PG complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / F6P complex [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000038027
AA Change: N471S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049355
Gene: ENSMUSG00000036427
AA Change: N471S

DomainStartEndE-ValueType
Pfam:PGI 54 546 1e-265 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135243
Predicted Effect unknown
Transcript: ENSMUST00000205800
AA Change: N103S
Predicted Effect probably benign
Transcript: ENSMUST00000205865
Predicted Effect probably benign
Transcript: ENSMUST00000205870
Predicted Effect probably benign
Transcript: ENSMUST00000205983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206232
Predicted Effect probably benign
Transcript: ENSMUST00000206415
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glucose phosphate isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In the cytoplasm, the gene product functions as a glycolytic enzyme (glucose-6-phosphate isomerase) that interconverts glucose-6-phosphate and fructose-6-phosphate. Extracellularly, the encoded protein (also referred to as neuroleukin) functions as a neurotrophic factor that promotes survival of skeletal motor neurons and sensory neurons, and as a lymphokine that induces immunoglobulin secretion. The encoded protein is also referred to as autocrine motility factor based on an additional function as a tumor-secreted cytokine and angiogenic factor. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for null mutations fail to develop beyond the egg cylinder stage and die by embryonic day 9.5. Homozygotes for a hypomorphic mutation exhibit nonspherocytic hemolytic anemia with hepatosplenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Gpi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Gpi1 APN 7 34215950 intron probably benign
IGL01911:Gpi1 APN 7 34220922 missense probably damaging 1.00
IGL02155:Gpi1 APN 7 34230189 missense possibly damaging 0.94
R0019:Gpi1 UTSW 7 34220899 missense probably damaging 0.99
R1413:Gpi1 UTSW 7 34230155 missense probably benign 0.22
R1974:Gpi1 UTSW 7 34220803 intron probably null
R2132:Gpi1 UTSW 7 34205914 missense probably damaging 1.00
R2254:Gpi1 UTSW 7 34202877 missense probably damaging 1.00
R2435:Gpi1 UTSW 7 34205829 missense probably damaging 1.00
R2509:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R2510:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R3408:Gpi1 UTSW 7 34202679 missense probably damaging 0.99
R5059:Gpi1 UTSW 7 34207688 missense probably damaging 1.00
R5141:Gpi1 UTSW 7 34227096 intron probably benign
R5272:Gpi1 UTSW 7 34220690 missense probably damaging 1.00
R5980:Gpi1 UTSW 7 34228926 critical splice donor site probably null
R6261:Gpi1 UTSW 7 34220745 missense possibly damaging 0.93
R6788:Gpi1 UTSW 7 34228990 missense probably damaging 1.00
R6835:Gpi1 UTSW 7 34227138 missense possibly damaging 0.89
R6989:Gpi1 UTSW 7 34202520 missense probably damaging 1.00
RF012:Gpi1 UTSW 7 34202477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATACATGGCTGCAGAG -3'
(R):5'- TGACTCTGGTCCTGGAATATGG -3'

Sequencing Primer
(F):5'- CTCATACATGGCTGCAGAGGAAAC -3'
(R):5'- CAAGACAATGTCTCCTTGGAGTC -3'
Posted On2014-10-16