Incidental Mutation 'R2255:D130043K22Rik'
ID241975
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene NameRIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission 040255-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2255 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24845135-24901270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24856911 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 105 (R105S)
Ref Sequence ENSEMBL: ENSMUSP00000116004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
Predicted Effect probably damaging
Transcript: ENSMUST00000006893
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: R105S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141572
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: R105S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7986:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCTCAAACCTTCTCCG -3'
(R):5'- TACTCTGCGCTACCTCTAGG -3'

Sequencing Primer
(F):5'- TCCGTGGGAGACTGCAC -3'
(R):5'- CCCGCTCCAGGTCTTTG -3'
Posted On2014-10-16