Incidental Mutation 'R2255:Spag6l'
ID241981
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Namesperm associated antigen 6-like
SynonymsPF16, Spag6
MMRRC Submission 040255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2255 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16753016-16829456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16777339 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 394 (E394G)
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468]
Predicted Effect probably damaging
Transcript: ENSMUST00000023468
AA Change: E394G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783
AA Change: E394G

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16780733 missense probably benign 0.20
IGL00928:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16781857 missense probably damaging 1.00
IGL02380:Spag6l APN 16 16763169 critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16780728 missense probably damaging 1.00
R0284:Spag6l UTSW 16 16780766 missense probably damaging 0.99
R0394:Spag6l UTSW 16 16780629 missense probably benign
R0720:Spag6l UTSW 16 16767096 splice site probably benign
R1205:Spag6l UTSW 16 16787307 missense probably damaging 1.00
R1496:Spag6l UTSW 16 16780614 splice site probably benign
R1707:Spag6l UTSW 16 16780628 missense probably benign 0.00
R1926:Spag6l UTSW 16 16763057 missense probably benign 0.00
R2330:Spag6l UTSW 16 16829085 missense probably benign
R3755:Spag6l UTSW 16 16763020 critical splice donor site probably null
R3796:Spag6l UTSW 16 16763052 missense probably damaging 1.00
R4093:Spag6l UTSW 16 16829024 missense probably benign 0.05
R4324:Spag6l UTSW 16 16787235 missense probably benign 0.00
R4725:Spag6l UTSW 16 16792531 missense probably damaging 1.00
R4766:Spag6l UTSW 16 16777390 missense probably benign 0.03
R4877:Spag6l UTSW 16 16781758 missense possibly damaging 0.47
R5753:Spag6l UTSW 16 16766967 critical splice donor site probably null
R5958:Spag6l UTSW 16 16763021 critical splice donor site probably null
R6107:Spag6l UTSW 16 16781788 missense possibly damaging 0.56
R6894:Spag6l UTSW 16 16783938 missense probably damaging 1.00
R7329:Spag6l UTSW 16 16767019 missense probably benign
R7634:Spag6l UTSW 16 16777414 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAGCACCCTCTTAAAGACAAAGG -3'
(R):5'- AGATTCATCAAGTCCACTCTAGG -3'

Sequencing Primer
(F):5'- CACCCTCTTAAAGACAAAGGAGAGG -3'
(R):5'- ATATAACATTTGCTGTTTGGGTCCC -3'
Posted On2014-10-16