Incidental Mutation 'R2255:Greb1l'
ID241992
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 040255-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2255 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10554857 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1634 (N1634K)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977]
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: N1634K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: N1634K

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173261
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATAAGACCTACCACCAAAGG -3'
(R):5'- ATGACCTGCATCCATGAGC -3'

Sequencing Primer
(F):5'- GCCAGCTTCTCATGACAGTCAG -3'
(R):5'- ATGAGCCTGACCTACCTGTTGAAG -3'
Posted On2014-10-16