Incidental Mutation 'R2266:Med23'
ID 242050
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 040266-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2266 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 24869986-24913681 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 24874601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 109 (S109A)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176313] [ENSMUST00000176502] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: S109A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: S109A

Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
AA Change: S109A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: S109A

Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176313
AA Change: S82A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135751
Gene: ENSMUSG00000019984
AA Change: S82A

Pfam:Med23 1 197 1.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177175
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
AI314180 A T 4: 58,830,332 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bsn T A 9: 108,115,124 D1143V probably damaging Het
Cacna2d2 T C 9: 107,513,280 V317A probably damaging Het
Cdh1 G A 8: 106,662,003 V564I probably benign Het
Cep250 T C 2: 155,976,170 V814A probably benign Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyb561d1 A T 3: 108,199,404 H166Q probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgkd A G 1: 87,927,818 probably benign Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Eid1 A G 2: 125,673,424 D78G possibly damaging Het
Emid1 T A 11: 5,144,331 Q60L probably damaging Het
Fam135a A T 1: 24,028,797 V801E probably benign Het
Foxh1 A G 15: 76,668,620 V298A probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Klra10 A G 6: 130,269,301 V237A probably benign Het
Klre1 A G 6: 129,585,630 K206R probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Naip6 A G 13: 100,283,559 V1401A possibly damaging Het
Ncapg2 A G 12: 116,429,676 E500G probably damaging Het
Nlrp12 T C 7: 3,233,945 I775V probably benign Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Polq C A 16: 37,062,153 Q1560K possibly damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Ptprm A T 17: 66,725,851 probably null Het
Ripk2 A T 4: 16,152,011 S183T possibly damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rttn A G 18: 89,064,171 N1407S probably benign Het
Sec14l1 A T 11: 117,156,488 H664L probably damaging Het
Slc10a7 G A 8: 78,509,635 G21S probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spesp1 A T 9: 62,273,552 L25M probably damaging Het
St6galnac1 G A 11: 116,767,847 Q264* probably null Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tnfsf13b A T 8: 10,007,306 R125S probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vmn1r38 G T 6: 66,776,449 Q228K probably benign Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Xrn1 A G 9: 96,006,712 D948G possibly damaging Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zfp418 G A 7: 7,182,808 R590K probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
R8975:Med23 UTSW 10 24904436 missense probably benign 0.42
R9131:Med23 UTSW 10 24904381 missense
R9202:Med23 UTSW 10 24904304 missense probably benign 0.12
R9341:Med23 UTSW 10 24912807 missense probably benign
R9342:Med23 UTSW 10 24874571 missense probably benign 0.01
R9343:Med23 UTSW 10 24912807 missense probably benign
R9412:Med23 UTSW 10 24902121 missense probably damaging 1.00
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-16