Incidental Mutation 'R2266:Rttn'
ID242076
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission 040266-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2266 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89064171 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1407 (N1407S)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
Predicted Effect probably benign
Transcript: ENSMUST00000023828
AA Change: N1407S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: N1407S

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Meta Mutation Damage Score 0.1122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (68/68)
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
AI314180 A T 4: 58,830,332 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bsn T A 9: 108,115,124 D1143V probably damaging Het
Cacna2d2 T C 9: 107,513,280 V317A probably damaging Het
Cdh1 G A 8: 106,662,003 V564I probably benign Het
Cep250 T C 2: 155,976,170 V814A probably benign Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyb561d1 A T 3: 108,199,404 H166Q probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgkd A G 1: 87,927,818 probably benign Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Eid1 A G 2: 125,673,424 D78G possibly damaging Het
Emid1 T A 11: 5,144,331 Q60L probably damaging Het
Fam135a A T 1: 24,028,797 V801E probably benign Het
Foxh1 A G 15: 76,668,620 V298A probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klra10 A G 6: 130,269,301 V237A probably benign Het
Klre1 A G 6: 129,585,630 K206R probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Med23 T G 10: 24,874,601 S109A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Naip6 A G 13: 100,283,559 V1401A possibly damaging Het
Ncapg2 A G 12: 116,429,676 E500G probably damaging Het
Nlrp12 T C 7: 3,233,945 I775V probably benign Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Polq C A 16: 37,062,153 Q1560K possibly damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Ptprm A T 17: 66,725,851 probably null Het
Ripk2 A T 4: 16,152,011 S183T possibly damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Sec14l1 A T 11: 117,156,488 H664L probably damaging Het
Slc10a7 G A 8: 78,509,635 G21S probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spesp1 A T 9: 62,273,552 L25M probably damaging Het
St6galnac1 G A 11: 116,767,847 Q264* probably null Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tnfsf13b A T 8: 10,007,306 R125S probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vmn1r38 G T 6: 66,776,449 Q228K probably benign Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Xrn1 A G 9: 96,006,712 D948G possibly damaging Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zfp418 G A 7: 7,182,808 R590K probably benign Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 intron probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 intron probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATGTAGGACACTGTTTCTGAGTG -3'
(R):5'- AATGAGGCTTATAGGCACTCTTG -3'

Sequencing Primer
(F):5'- GTAAAACCAATGCCATATTTGTGCAG -3'
(R):5'- GAGGCTTATAGGCACTCTTGTAAAAG -3'
Posted On2014-10-16