Incidental Mutation 'R2267:P2ry14'
ID242095
Institutional Source Beutler Lab
Gene Symbol P2ry14
Ensembl Gene ENSMUSG00000036381
Gene Namepurinergic receptor P2Y, G-protein coupled, 14
SynonymsGpr105, P2Y14, A330108O13Rik
MMRRC Submission 040267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2267 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59113855-59153618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59115571 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 165 (N165S)
Ref Sequence ENSEMBL: ENSMUSP00000142934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000065220] [ENSMUST00000091112] [ENSMUST00000164225] [ENSMUST00000196081] [ENSMUST00000197220] [ENSMUST00000197841] [ENSMUST00000198838] [ENSMUST00000199659] [ENSMUST00000200358] [ENSMUST00000200673]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065220
AA Change: N156S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066669
Gene: ENSMUSG00000036381
AA Change: N156S

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091112
AA Change: N156S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088642
Gene: ENSMUSG00000036381
AA Change: N156S

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 4.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196081
AA Change: N156S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142601
Gene: ENSMUSG00000036381
AA Change: N156S

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197220
AA Change: N156S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143070
Gene: ENSMUSG00000036381
AA Change: N156S

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197841
AA Change: N165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142934
Gene: ENSMUSG00000036381
AA Change: N165S

DomainStartEndE-ValueType
Pfam:7tm_1 49 304 1.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198838
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200358
SMART Domains Protein: ENSMUSP00000142641
Gene: ENSMUSG00000036381

DomainStartEndE-ValueType
Pfam:7tm_1 39 110 8.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200673
Meta Mutation Damage Score 0.4149 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors, which contains several receptor subtypes with different pharmacological selectivity for various adenosine and uridine nucleotides. This receptor is a P2Y purinergic receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. It has been implicated in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to exhibit increased glucose mediated forestomach muscle tension. Mice homozygous for a different null allele show decreased gastrointestinal emptying, impaired glucose tolerance, decreased glucose-stimulated insulin release, and reduced airway responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8b G A 11: 109,955,148 T820M probably benign Het
Acot2 C T 12: 83,990,560 A216V probably damaging Het
Agap2 T A 10: 127,082,428 probably benign Het
Ak7 T C 12: 105,747,214 V419A probably benign Het
Apmap A G 2: 150,588,901 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Cachd1 T A 4: 100,949,069 probably benign Het
Ccdc39 T A 3: 33,815,484 E731D probably damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgcr14 T C 16: 17,909,995 T107A probably damaging Het
Dgke T A 11: 89,052,469 E231D probably benign Het
Dhrs9 A G 2: 69,392,853 probably benign Het
Dhx30 C T 9: 110,087,034 G662R probably damaging Het
Dnah7b T A 1: 46,233,915 M2401K probably damaging Het
Dnmt3a T A 12: 3,897,551 probably null Het
Dst C T 1: 34,295,466 T4874I probably damaging Het
Eef2kmt G A 16: 5,255,940 probably benign Het
Etfa A T 9: 55,486,731 L212Q probably damaging Het
Exosc5 T C 7: 25,664,384 L107P possibly damaging Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fam186b T G 15: 99,285,643 D40A probably damaging Het
Fga T C 3: 83,032,950 L637P probably damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gcc1 A G 6: 28,418,499 S612P probably benign Het
Gjd3 C T 11: 98,982,401 V206M probably damaging Het
Gpam A T 19: 55,072,710 probably null Het
Gpc6 A T 14: 117,888,520 probably null Het
Gphb5 C G 12: 75,412,946 V92L probably benign Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Gsdmc T C 15: 63,776,798 E429G probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hmcn1 T C 1: 150,599,010 S4709G probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnt2 G A 1: 140,573,683 probably null Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Klrb1 A T 6: 128,722,974 S25T probably damaging Het
L3mbtl3 C T 10: 26,331,857 W321* probably null Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrtm1 C A 6: 77,244,013 A151E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mcc T C 18: 44,519,541 D272G probably damaging Het
Mgst3 T A 1: 167,373,799 T106S probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mlh3 G T 12: 85,260,811 H1181N possibly damaging Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mro T C 18: 73,873,297 I104T probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Neurod2 C A 11: 98,327,756 C194F probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Nup205 T C 6: 35,241,349 S1819P possibly damaging Het
Obsl1 T C 1: 75,505,698 H176R probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr836 A T 9: 19,121,441 H162L probably benign Het
Olfr926 A G 9: 38,878,063 T296A probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Plxnd1 A G 6: 115,962,743 V1425A probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Ptpn12 A T 5: 20,998,411 N456K probably damaging Het
Scarb1 A T 5: 125,287,375 S97T possibly damaging Het
Scyl1 C T 19: 5,761,721 D440N possibly damaging Het
Sema5a C A 15: 32,574,919 T391K probably benign Het
Sipa1l3 T A 7: 29,399,602 N414I probably damaging Het
Skint6 T C 4: 112,842,822 probably null Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spib T A 7: 44,528,924 M141L probably benign Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Taf15 T G 11: 83,497,262 S200R probably damaging Het
Tanc1 G A 2: 59,837,219 probably null Het
Tas2r134 A G 2: 51,628,237 T243A probably benign Het
Tatdn1 A T 15: 58,905,752 M218K probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmprss11d A G 5: 86,373,349 Y2H probably benign Het
Trps1 G A 15: 50,822,398 R544C probably damaging Het
Ttc22 T C 4: 106,639,085 V444A possibly damaging Het
Ttc28 A G 5: 111,226,003 T1071A possibly damaging Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Ube2j1 T A 4: 33,049,943 F257I possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Wwp1 T C 4: 19,638,618 D575G probably damaging Het
Other mutations in P2ry14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:P2ry14 APN 3 59115335 missense probably damaging 1.00
R0091:P2ry14 UTSW 3 59115893 missense probably benign 0.01
R0511:P2ry14 UTSW 3 59116028 missense possibly damaging 0.89
R0518:P2ry14 UTSW 3 59115204 missense probably damaging 1.00
R0638:P2ry14 UTSW 3 59115448 missense probably benign 0.00
R1167:P2ry14 UTSW 3 59115131 missense probably damaging 0.99
R1540:P2ry14 UTSW 3 59115265 missense probably benign 0.08
R1795:P2ry14 UTSW 3 59115853 missense probably damaging 1.00
R2025:P2ry14 UTSW 3 59115445 missense probably damaging 1.00
R2096:P2ry14 UTSW 3 59115317 missense probably damaging 1.00
R2265:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2266:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R4664:P2ry14 UTSW 3 59115142 missense probably damaging 1.00
R5294:P2ry14 UTSW 3 59115568 missense possibly damaging 0.93
R5721:P2ry14 UTSW 3 59115031 splice site probably null
R5969:P2ry14 UTSW 3 59115158 missense probably damaging 1.00
R6077:P2ry14 UTSW 3 59115377 missense probably damaging 0.99
R6619:P2ry14 UTSW 3 59115733 missense probably damaging 1.00
R7222:P2ry14 UTSW 3 59115382 missense probably benign 0.00
R7452:P2ry14 UTSW 3 59116045 missense probably benign
R8092:P2ry14 UTSW 3 59115446 missense probably damaging 1.00
R8698:P2ry14 UTSW 3 59115175 missense possibly damaging 0.78
RF017:P2ry14 UTSW 3 59115046 missense probably benign 0.03
Z1176:P2ry14 UTSW 3 59115737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCTTCCTCGTGATGGCC -3'
(R):5'- AAAGTCCTTGGTGACTCAGGC -3'

Sequencing Primer
(F):5'- TCGTGATGGCCGTGTAGAAGAC -3'
(R):5'- AGGGTCTCTGCCGTCATC -3'
Posted On2014-10-16