Incidental Mutation 'R2267:Fga'
ID242098
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 040267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R2267 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83032950 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 637 (L637P)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: L637P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: L637P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.8623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8b G A 11: 109,955,148 T820M probably benign Het
Acot2 C T 12: 83,990,560 A216V probably damaging Het
Agap2 T A 10: 127,082,428 probably benign Het
Ak7 T C 12: 105,747,214 V419A probably benign Het
Apmap A G 2: 150,588,901 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Cachd1 T A 4: 100,949,069 probably benign Het
Ccdc39 T A 3: 33,815,484 E731D probably damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgcr14 T C 16: 17,909,995 T107A probably damaging Het
Dgke T A 11: 89,052,469 E231D probably benign Het
Dhrs9 A G 2: 69,392,853 probably benign Het
Dhx30 C T 9: 110,087,034 G662R probably damaging Het
Dnah7b T A 1: 46,233,915 M2401K probably damaging Het
Dnmt3a T A 12: 3,897,551 probably null Het
Dst C T 1: 34,295,466 T4874I probably damaging Het
Eef2kmt G A 16: 5,255,940 probably benign Het
Etfa A T 9: 55,486,731 L212Q probably damaging Het
Exosc5 T C 7: 25,664,384 L107P possibly damaging Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fam186b T G 15: 99,285,643 D40A probably damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gcc1 A G 6: 28,418,499 S612P probably benign Het
Gjd3 C T 11: 98,982,401 V206M probably damaging Het
Gpam A T 19: 55,072,710 probably null Het
Gpc6 A T 14: 117,888,520 probably null Het
Gphb5 C G 12: 75,412,946 V92L probably benign Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Gsdmc T C 15: 63,776,798 E429G probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hmcn1 T C 1: 150,599,010 S4709G probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnt2 G A 1: 140,573,683 probably null Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Klrb1 A T 6: 128,722,974 S25T probably damaging Het
L3mbtl3 C T 10: 26,331,857 W321* probably null Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrtm1 C A 6: 77,244,013 A151E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mcc T C 18: 44,519,541 D272G probably damaging Het
Mgst3 T A 1: 167,373,799 T106S probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mlh3 G T 12: 85,260,811 H1181N possibly damaging Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mro T C 18: 73,873,297 I104T probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Neurod2 C A 11: 98,327,756 C194F probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Nup205 T C 6: 35,241,349 S1819P possibly damaging Het
Obsl1 T C 1: 75,505,698 H176R probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr836 A T 9: 19,121,441 H162L probably benign Het
Olfr926 A G 9: 38,878,063 T296A probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Plxnd1 A G 6: 115,962,743 V1425A probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Ptpn12 A T 5: 20,998,411 N456K probably damaging Het
Scarb1 A T 5: 125,287,375 S97T possibly damaging Het
Scyl1 C T 19: 5,761,721 D440N possibly damaging Het
Sema5a C A 15: 32,574,919 T391K probably benign Het
Sipa1l3 T A 7: 29,399,602 N414I probably damaging Het
Skint6 T C 4: 112,842,822 probably null Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spib T A 7: 44,528,924 M141L probably benign Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Taf15 T G 11: 83,497,262 S200R probably damaging Het
Tanc1 G A 2: 59,837,219 probably null Het
Tas2r134 A G 2: 51,628,237 T243A probably benign Het
Tatdn1 A T 15: 58,905,752 M218K probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmprss11d A G 5: 86,373,349 Y2H probably benign Het
Trps1 G A 15: 50,822,398 R544C probably damaging Het
Ttc22 T C 4: 106,639,085 V444A possibly damaging Het
Ttc28 A G 5: 111,226,003 T1071A possibly damaging Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Ube2j1 T A 4: 33,049,943 F257I possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Wwp1 T C 4: 19,638,618 D575G probably damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCCACCTGGATCCAGTAAG -3'
(R):5'- AAGGTACTGAACTGCATGTTGC -3'

Sequencing Primer
(F):5'- TTTAACCGGACCTGGCAA -3'
(R):5'- GTGAGGTGTATTCTGTCCCCTC -3'
Posted On2014-10-16