Mutagenetix > Incidental Mutation

Incidental Mutation 'R2267:Skint6'

242107

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

040267-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R2267 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

splice site (83 bp from exon)

DNA Base Change (assembly)

T to C at 112842822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably null
Transcript: ENSMUST00000138966

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171224

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (108/110)

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578C19Rik	A	G	X: 18,423,687	S179P	possibly damaging	Het
Aadac	T	A	3: 60,037,316	D136E	probably damaging	Het
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Abca8b	G	A	11: 109,955,148	T820M	probably benign	Het
Acot2	C	T	12: 83,990,560	A216V	probably damaging	Het
Agap2	T	A	10: 127,082,428		probably benign	Het
Ak7	T	C	12: 105,747,214	V419A	probably benign	Het
Apmap	A	G	2: 150,588,901		probably null	Het
Apob	T	C	12: 8,015,475	F4115S	possibly damaging	Het
Cachd1	T	A	4: 100,949,069		probably benign	Het
Ccdc39	T	A	3: 33,815,484	E731D	probably damaging	Het
Ces2a	A	T	8: 104,740,190	I65F	probably benign	Het
Commd8	A	G	5: 72,165,422	W51R	probably damaging	Het
D2hgdh	C	T	1: 93,835,435	A314V	probably damaging	Het
Dcun1d4	T	A	5: 73,481,275		probably benign	Het
Dgcr14	T	C	16: 17,909,995	T107A	probably damaging	Het
Dgke	T	A	11: 89,052,469	E231D	probably benign	Het
Dhrs9	A	G	2: 69,392,853		probably benign	Het
Dhx30	C	T	9: 110,087,034	G662R	probably damaging	Het
Dnah7b	T	A	1: 46,233,915	M2401K	probably damaging	Het
Dnmt3a	T	A	12: 3,897,551		probably null	Het
Dst	C	T	1: 34,295,466	T4874I	probably damaging	Het
Eef2kmt	G	A	16: 5,255,940		probably benign	Het
Etfa	A	T	9: 55,486,731	L212Q	probably damaging	Het
Exosc5	T	C	7: 25,664,384	L107P	possibly damaging	Het
Fam117b	T	C	1: 59,913,630	L156P	probably damaging	Het
Fam186b	T	G	15: 99,285,643	D40A	probably damaging	Het
Fga	T	C	3: 83,032,950	L637P	probably damaging	Het
Foxn4	T	C	5: 114,255,601	T486A	probably damaging	Het
Gcc1	A	G	6: 28,418,499	S612P	probably benign	Het
Gjd3	C	T	11: 98,982,401	V206M	probably damaging	Het
Gpam	A	T	19: 55,072,710		probably null	Het
Gpc6	A	T	14: 117,888,520		probably null	Het
Gphb5	C	G	12: 75,412,946	V92L	probably benign	Het
Grid2ip	C	T	5: 143,386,092	P690L	probably benign	Het
Gsdmc	T	C	15: 63,776,798	E429G	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hist1h2bh	T	C	13: 23,542,992	K121E	possibly damaging	Het
Hmcn1	T	C	1: 150,599,010	S4709G	probably benign	Het
Hr	A	T	14: 70,558,107	D393V	probably benign	Het
Ido2	T	C	8: 24,535,252	Y253C	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Itih4	A	G	14: 30,892,428	D445G	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kcnt2	G	A	1: 140,573,683		probably null	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Klrb1	A	T	6: 128,722,974	S25T	probably damaging	Het
L3mbtl3	C	T	10: 26,331,857	W321*	probably null	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lrrtm1	C	A	6: 77,244,013	A151E	probably damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Magi3	G	A	3: 104,021,066		probably benign	Het
Mamdc2	A	T	19: 23,303,903		probably benign	Het
Mcc	T	C	18: 44,519,541	D272G	probably damaging	Het
Mgst3	T	A	1: 167,373,799	T106S	probably benign	Het
Mink1	G	A	11: 70,601,724		probably null	Het
Mlh3	G	T	12: 85,260,811	H1181N	possibly damaging	Het
Mmrn2	A	G	14: 34,399,492	K773R	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mro	T	C	18: 73,873,297	I104T	probably benign	Het
Mtbp	G	A	15: 55,569,160		probably null	Het
Mtss1l	A	G	8: 110,728,730	K92E	possibly damaging	Het
Mybphl	A	G	3: 108,365,001	E2G	probably damaging	Het
Nbeal1	T	A	1: 60,330,878		probably benign	Het
Neurod2	C	A	11: 98,327,756	C194F	probably damaging	Het
Nr4a2	T	A	2: 57,112,006	D145V	possibly damaging	Het
Ntmt1	C	A	2: 30,820,460	N58K	probably benign	Het
Nup205	T	C	6: 35,241,349	S1819P	possibly damaging	Het
Obsl1	T	C	1: 75,505,698	H176R	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Olfr836	A	T	9: 19,121,441	H162L	probably benign	Het
Olfr926	A	G	9: 38,878,063	T296A	probably benign	Het
P2ry13	T	C	3: 59,210,028	M110V	probably damaging	Het
P2ry14	T	C	3: 59,115,571	N165S	probably damaging	Het
Phka1	A	G	X: 102,541,110		probably benign	Het
Plxnd1	A	G	6: 115,962,743	V1425A	probably benign	Het
Ppp2ca	G	A	11: 52,118,086	G138R	probably damaging	Het
Ptpn12	A	T	5: 20,998,411	N456K	probably damaging	Het
Scarb1	A	T	5: 125,287,375	S97T	possibly damaging	Het
Scyl1	C	T	19: 5,761,721	D440N	possibly damaging	Het
Sema5a	C	A	15: 32,574,919	T391K	probably benign	Het
Sipa1l3	T	A	7: 29,399,602	N414I	probably damaging	Het
Slc35a3	T	C	3: 116,673,636	K325E	possibly damaging	Het
Spag17	C	A	3: 100,061,866		probably null	Het
Spib	T	A	7: 44,528,924	M141L	probably benign	Het
Srebf1	A	G	11: 60,207,147	S44P	probably damaging	Het
Styk1	T	C	6: 131,312,576	E25G	probably benign	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Taf15	T	G	11: 83,497,262	S200R	probably damaging	Het
Tanc1	G	A	2: 59,837,219		probably null	Het
Tas2r134	A	G	2: 51,628,237	T243A	probably benign	Het
Tatdn1	A	T	15: 58,905,752	M218K	probably damaging	Het
Tbc1d14	A	G	5: 36,543,217	L269P	possibly damaging	Het
Tbx1	T	C	16: 18,581,994		probably null	Het
Tgfbr3l	A	G	8: 4,250,506	E228G	probably benign	Het
Tmem233	G	C	5: 116,051,458		probably benign	Het
Tmprss11d	A	G	5: 86,373,349	Y2H	probably benign	Het
Trps1	G	A	15: 50,822,398	R544C	probably damaging	Het
Ttc22	T	C	4: 106,639,085	V444A	possibly damaging	Het
Ttc28	A	G	5: 111,226,003	T1071A	possibly damaging	Het
Tymp	A	T	15: 89,373,808	V378D	probably damaging	Het
Ube2j1	T	A	4: 33,049,943	F257I	possibly damaging	Het
Vmn2r18	T	C	5: 151,586,662	E82G	probably damaging	Het
Wwp1	T	C	4: 19,638,618	D575G	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATTATAAATCTTTTAAAGGGGCCACTC -3'
(R):5'- AGCTCTAGGCAACACAGCA -3'

Sequencing Primer
(F):5'- TAAAGGGGCCACTCTGAGTTC -3'
(R):5'- TCTAAAGCATGCTACTGCTAGC -3'

Posted On

2014-10-16