Incidental Mutation 'R2267:Ptpn12'
ID242108
Institutional Source Beutler Lab
Gene Symbol Ptpn12
Ensembl Gene ENSMUSG00000028771
Gene Nameprotein tyrosine phosphatase, non-receptor type 12
SynonymsP19-PTP, PTP-PEST, PTP-P19
MMRRC Submission 040267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2267 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location20986645-21055911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20998411 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 456 (N456K)
Ref Sequence ENSEMBL: ENSMUSP00000030556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813]
Predicted Effect probably damaging
Transcript: ENSMUST00000030556
AA Change: N456K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: N456K

DomainStartEndE-ValueType
PTPc 27 295 2.14e-126 SMART
Blast:PTPc 338 399 7e-12 BLAST
low complexity region 499 518 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148711
Predicted Effect probably benign
Transcript: ENSMUST00000151813
Meta Mutation Damage Score 0.1023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8b G A 11: 109,955,148 T820M probably benign Het
Acot2 C T 12: 83,990,560 A216V probably damaging Het
Agap2 T A 10: 127,082,428 probably benign Het
Ak7 T C 12: 105,747,214 V419A probably benign Het
Apmap A G 2: 150,588,901 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Cachd1 T A 4: 100,949,069 probably benign Het
Ccdc39 T A 3: 33,815,484 E731D probably damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgcr14 T C 16: 17,909,995 T107A probably damaging Het
Dgke T A 11: 89,052,469 E231D probably benign Het
Dhrs9 A G 2: 69,392,853 probably benign Het
Dhx30 C T 9: 110,087,034 G662R probably damaging Het
Dnah7b T A 1: 46,233,915 M2401K probably damaging Het
Dnmt3a T A 12: 3,897,551 probably null Het
Dst C T 1: 34,295,466 T4874I probably damaging Het
Eef2kmt G A 16: 5,255,940 probably benign Het
Etfa A T 9: 55,486,731 L212Q probably damaging Het
Exosc5 T C 7: 25,664,384 L107P possibly damaging Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fam186b T G 15: 99,285,643 D40A probably damaging Het
Fga T C 3: 83,032,950 L637P probably damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gcc1 A G 6: 28,418,499 S612P probably benign Het
Gjd3 C T 11: 98,982,401 V206M probably damaging Het
Gpam A T 19: 55,072,710 probably null Het
Gpc6 A T 14: 117,888,520 probably null Het
Gphb5 C G 12: 75,412,946 V92L probably benign Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Gsdmc T C 15: 63,776,798 E429G probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hmcn1 T C 1: 150,599,010 S4709G probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnt2 G A 1: 140,573,683 probably null Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Klrb1 A T 6: 128,722,974 S25T probably damaging Het
L3mbtl3 C T 10: 26,331,857 W321* probably null Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrtm1 C A 6: 77,244,013 A151E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mcc T C 18: 44,519,541 D272G probably damaging Het
Mgst3 T A 1: 167,373,799 T106S probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mlh3 G T 12: 85,260,811 H1181N possibly damaging Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mro T C 18: 73,873,297 I104T probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Neurod2 C A 11: 98,327,756 C194F probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Nup205 T C 6: 35,241,349 S1819P possibly damaging Het
Obsl1 T C 1: 75,505,698 H176R probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr836 A T 9: 19,121,441 H162L probably benign Het
Olfr926 A G 9: 38,878,063 T296A probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Plxnd1 A G 6: 115,962,743 V1425A probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Scarb1 A T 5: 125,287,375 S97T possibly damaging Het
Scyl1 C T 19: 5,761,721 D440N possibly damaging Het
Sema5a C A 15: 32,574,919 T391K probably benign Het
Sipa1l3 T A 7: 29,399,602 N414I probably damaging Het
Skint6 T C 4: 112,842,822 probably null Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spib T A 7: 44,528,924 M141L probably benign Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Taf15 T G 11: 83,497,262 S200R probably damaging Het
Tanc1 G A 2: 59,837,219 probably null Het
Tas2r134 A G 2: 51,628,237 T243A probably benign Het
Tatdn1 A T 15: 58,905,752 M218K probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmprss11d A G 5: 86,373,349 Y2H probably benign Het
Trps1 G A 15: 50,822,398 R544C probably damaging Het
Ttc22 T C 4: 106,639,085 V444A possibly damaging Het
Ttc28 A G 5: 111,226,003 T1071A possibly damaging Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Ube2j1 T A 4: 33,049,943 F257I possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Wwp1 T C 4: 19,638,618 D575G probably damaging Het
Other mutations in Ptpn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ptpn12 APN 5 21029850 missense probably damaging 1.00
IGL00226:Ptpn12 APN 5 20998668 missense probably damaging 1.00
IGL01432:Ptpn12 APN 5 20998555 nonsense probably null
IGL02285:Ptpn12 APN 5 21055713 missense probably benign 0.40
IGL02488:Ptpn12 APN 5 21022062 missense possibly damaging 0.72
IGL02550:Ptpn12 APN 5 20998139 missense probably benign 0.00
IGL02640:Ptpn12 APN 5 21019246 missense probably damaging 1.00
IGL02652:Ptpn12 APN 5 21002437 missense probably benign 0.04
IGL03130:Ptpn12 APN 5 21002612 unclassified probably benign
R0531:Ptpn12 UTSW 5 20998483 missense possibly damaging 0.53
R0948:Ptpn12 UTSW 5 20998043 missense probably benign
R1018:Ptpn12 UTSW 5 21029869 missense possibly damaging 0.94
R1184:Ptpn12 UTSW 5 20998356 missense possibly damaging 0.86
R1699:Ptpn12 UTSW 5 20998170 missense probably benign 0.01
R1938:Ptpn12 UTSW 5 20993263 missense probably damaging 1.00
R1952:Ptpn12 UTSW 5 20998310 missense probably benign 0.34
R2152:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2153:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2154:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2358:Ptpn12 UTSW 5 20998692 missense probably damaging 1.00
R3551:Ptpn12 UTSW 5 20989049 missense possibly damaging 0.67
R3931:Ptpn12 UTSW 5 21001323 missense probably benign 0.00
R4013:Ptpn12 UTSW 5 20992743 missense probably benign 0.05
R4039:Ptpn12 UTSW 5 21002510 nonsense probably null
R4501:Ptpn12 UTSW 5 21019280 missense probably damaging 1.00
R4748:Ptpn12 UTSW 5 21005385 nonsense probably null
R4754:Ptpn12 UTSW 5 20998589 missense probably benign 0.34
R4963:Ptpn12 UTSW 5 21015708 splice site probably null
R5160:Ptpn12 UTSW 5 20997831 missense probably damaging 1.00
R5581:Ptpn12 UTSW 5 21015726 missense probably damaging 1.00
R5789:Ptpn12 UTSW 5 20989015 missense possibly damaging 0.92
R5836:Ptpn12 UTSW 5 21009546 nonsense probably null
R6383:Ptpn12 UTSW 5 20987468 nonsense probably null
R6883:Ptpn12 UTSW 5 21055713 missense probably benign 0.40
R7544:Ptpn12 UTSW 5 21009511 missense probably damaging 1.00
R7885:Ptpn12 UTSW 5 20998525 missense possibly damaging 0.54
R7915:Ptpn12 UTSW 5 21009451 missense probably damaging 1.00
R7960:Ptpn12 UTSW 5 21055689 missense probably benign 0.01
R7976:Ptpn12 UTSW 5 21002633 nonsense probably null
R8032:Ptpn12 UTSW 5 20998043 missense probably benign
R8224:Ptpn12 UTSW 5 20998658 missense probably damaging 1.00
R8473:Ptpn12 UTSW 5 20998359 missense probably benign 0.00
R8823:Ptpn12 UTSW 5 20998623 missense probably damaging 1.00
X0004:Ptpn12 UTSW 5 21019296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTATCGAGAGGCAAGCAG -3'
(R):5'- GTGACAGGTACCACCCAAAG -3'

Sequencing Primer
(F):5'- GAGTTGCTCTGGGACTCCTC -3'
(R):5'- AGTGCTGCACATGGCCTC -3'
Posted On2014-10-16