Incidental Mutation 'R2267:L3mbtl3'
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
MMRRC Submission 040267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2267 (G1)
Quality Score225
Status Validated
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 26331857 bp
Amino Acid Change Tryptophan to Stop codon at position 321 (W321*)
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect probably null
Transcript: ENSMUST00000040219
AA Change: W321*
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: W321*

low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105519
AA Change: W296*
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: W296*

low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174766
AA Change: W321*
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: W321*

low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217699
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8b G A 11: 109,955,148 T820M probably benign Het
Acot2 C T 12: 83,990,560 A216V probably damaging Het
Agap2 T A 10: 127,082,428 probably benign Het
Ak7 T C 12: 105,747,214 V419A probably benign Het
Apmap A G 2: 150,588,901 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Cachd1 T A 4: 100,949,069 probably benign Het
Ccdc39 T A 3: 33,815,484 E731D probably damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgcr14 T C 16: 17,909,995 T107A probably damaging Het
Dgke T A 11: 89,052,469 E231D probably benign Het
Dhrs9 A G 2: 69,392,853 probably benign Het
Dhx30 C T 9: 110,087,034 G662R probably damaging Het
Dnah7b T A 1: 46,233,915 M2401K probably damaging Het
Dnmt3a T A 12: 3,897,551 probably null Het
Dst C T 1: 34,295,466 T4874I probably damaging Het
Eef2kmt G A 16: 5,255,940 probably benign Het
Etfa A T 9: 55,486,731 L212Q probably damaging Het
Exosc5 T C 7: 25,664,384 L107P possibly damaging Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fam186b T G 15: 99,285,643 D40A probably damaging Het
Fga T C 3: 83,032,950 L637P probably damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gcc1 A G 6: 28,418,499 S612P probably benign Het
Gjd3 C T 11: 98,982,401 V206M probably damaging Het
Gpam A T 19: 55,072,710 probably null Het
Gpc6 A T 14: 117,888,520 probably null Het
Gphb5 C G 12: 75,412,946 V92L probably benign Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Gsdmc T C 15: 63,776,798 E429G probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hmcn1 T C 1: 150,599,010 S4709G probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnt2 G A 1: 140,573,683 probably null Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Klrb1 A T 6: 128,722,974 S25T probably damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrtm1 C A 6: 77,244,013 A151E probably damaging Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mcc T C 18: 44,519,541 D272G probably damaging Het
Mgst3 T A 1: 167,373,799 T106S probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mlh3 G T 12: 85,260,811 H1181N possibly damaging Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mro T C 18: 73,873,297 I104T probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Neurod2 C A 11: 98,327,756 C194F probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Nup205 T C 6: 35,241,349 S1819P possibly damaging Het
Obsl1 T C 1: 75,505,698 H176R probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr836 A T 9: 19,121,441 H162L probably benign Het
Olfr926 A G 9: 38,878,063 T296A probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Plxnd1 A G 6: 115,962,743 V1425A probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Ptpn12 A T 5: 20,998,411 N456K probably damaging Het
Scarb1 A T 5: 125,287,375 S97T possibly damaging Het
Scyl1 C T 19: 5,761,721 D440N possibly damaging Het
Sema5a C A 15: 32,574,919 T391K probably benign Het
Sipa1l3 T A 7: 29,399,602 N414I probably damaging Het
Skint6 T C 4: 112,842,822 probably null Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spib T A 7: 44,528,924 M141L probably benign Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Taf15 T G 11: 83,497,262 S200R probably damaging Het
Tanc1 G A 2: 59,837,219 probably null Het
Tas2r134 A G 2: 51,628,237 T243A probably benign Het
Tatdn1 A T 15: 58,905,752 M218K probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmprss11d A G 5: 86,373,349 Y2H probably benign Het
Trps1 G A 15: 50,822,398 R544C probably damaging Het
Ttc22 T C 4: 106,639,085 V444A possibly damaging Het
Ttc28 A G 5: 111,226,003 T1071A possibly damaging Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Ube2j1 T A 4: 33,049,943 F257I possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Wwp1 T C 4: 19,638,618 D575G probably damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
R7490:L3mbtl3 UTSW 10 26339231 missense unknown
R7775:L3mbtl3 UTSW 10 26352317 missense unknown
R7815:L3mbtl3 UTSW 10 26280378 missense unknown
Z1177:L3mbtl3 UTSW 10 26280402 nonsense probably null
Z1177:L3mbtl3 UTSW 10 26302663 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16