Incidental Mutation 'R2267:Srebf1'
Institutional Source Beutler Lab
Gene Symbol Srebf1
Ensembl Gene ENSMUSG00000020538
Gene Namesterol regulatory element binding transcription factor 1
SynonymsSREBP-1a, SREBP-1c, ADD-1, SREBP1c, SREBP-1, bHLHd1, SREBP1
MMRRC Submission 040267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2267 (G1)
Quality Score225
Status Validated
Chromosomal Location60199089-60222581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60207147 bp
Amino Acid Change Serine to Proline at position 44 (S44P)
Ref Sequence ENSEMBL: ENSMUSP00000120777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020846] [ENSMUST00000144942]
Predicted Effect probably benign
Transcript: ENSMUST00000020846
AA Change: S68P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020846
Gene: ENSMUSG00000020538
AA Change: S68P

low complexity region 70 85 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
HLH 323 373 6.71e-16 SMART
low complexity region 420 453 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
low complexity region 1113 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129869
Predicted Effect unknown
Transcript: ENSMUST00000134660
AA Change: S14P
SMART Domains Protein: ENSMUSP00000122934
Gene: ENSMUSG00000020538
AA Change: S14P

low complexity region 17 32 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
HLH 265 315 6.71e-16 SMART
low complexity region 362 395 N/A INTRINSIC
transmembrane domain 422 444 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 1055 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136426
Predicted Effect probably damaging
Transcript: ENSMUST00000144942
AA Change: S44P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120777
Gene: ENSMUSG00000020538
AA Change: S44P

low complexity region 46 61 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 201 211 N/A INTRINSIC
HLH 299 349 6.71e-16 SMART
low complexity region 396 429 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185099
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of transcript A die between E11.5 and E14.5. Mice homozygous for a knock-out allele of transcript C exhibit decreased circulating triglyceride levels. Mice homozygous for a gene trap allele exhibit decreased hepatictriglyceride storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8b G A 11: 109,955,148 T820M probably benign Het
Acot2 C T 12: 83,990,560 A216V probably damaging Het
Agap2 T A 10: 127,082,428 probably benign Het
Ak7 T C 12: 105,747,214 V419A probably benign Het
Apmap A G 2: 150,588,901 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Cachd1 T A 4: 100,949,069 probably benign Het
Ccdc39 T A 3: 33,815,484 E731D probably damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgcr14 T C 16: 17,909,995 T107A probably damaging Het
Dgke T A 11: 89,052,469 E231D probably benign Het
Dhrs9 A G 2: 69,392,853 probably benign Het
Dhx30 C T 9: 110,087,034 G662R probably damaging Het
Dnah7b T A 1: 46,233,915 M2401K probably damaging Het
Dnmt3a T A 12: 3,897,551 probably null Het
Dst C T 1: 34,295,466 T4874I probably damaging Het
Eef2kmt G A 16: 5,255,940 probably benign Het
Etfa A T 9: 55,486,731 L212Q probably damaging Het
Exosc5 T C 7: 25,664,384 L107P possibly damaging Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fam186b T G 15: 99,285,643 D40A probably damaging Het
Fga T C 3: 83,032,950 L637P probably damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gcc1 A G 6: 28,418,499 S612P probably benign Het
Gjd3 C T 11: 98,982,401 V206M probably damaging Het
Gpam A T 19: 55,072,710 probably null Het
Gpc6 A T 14: 117,888,520 probably null Het
Gphb5 C G 12: 75,412,946 V92L probably benign Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Gsdmc T C 15: 63,776,798 E429G probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hmcn1 T C 1: 150,599,010 S4709G probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnt2 G A 1: 140,573,683 probably null Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Klrb1 A T 6: 128,722,974 S25T probably damaging Het
L3mbtl3 C T 10: 26,331,857 W321* probably null Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrtm1 C A 6: 77,244,013 A151E probably damaging Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mcc T C 18: 44,519,541 D272G probably damaging Het
Mgst3 T A 1: 167,373,799 T106S probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mlh3 G T 12: 85,260,811 H1181N possibly damaging Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mro T C 18: 73,873,297 I104T probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Neurod2 C A 11: 98,327,756 C194F probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Nup205 T C 6: 35,241,349 S1819P possibly damaging Het
Obsl1 T C 1: 75,505,698 H176R probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr836 A T 9: 19,121,441 H162L probably benign Het
Olfr926 A G 9: 38,878,063 T296A probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Plxnd1 A G 6: 115,962,743 V1425A probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Ptpn12 A T 5: 20,998,411 N456K probably damaging Het
Scarb1 A T 5: 125,287,375 S97T possibly damaging Het
Scyl1 C T 19: 5,761,721 D440N possibly damaging Het
Sema5a C A 15: 32,574,919 T391K probably benign Het
Sipa1l3 T A 7: 29,399,602 N414I probably damaging Het
Skint6 T C 4: 112,842,822 probably null Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spib T A 7: 44,528,924 M141L probably benign Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Taf15 T G 11: 83,497,262 S200R probably damaging Het
Tanc1 G A 2: 59,837,219 probably null Het
Tas2r134 A G 2: 51,628,237 T243A probably benign Het
Tatdn1 A T 15: 58,905,752 M218K probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmprss11d A G 5: 86,373,349 Y2H probably benign Het
Trps1 G A 15: 50,822,398 R544C probably damaging Het
Ttc22 T C 4: 106,639,085 V444A possibly damaging Het
Ttc28 A G 5: 111,226,003 T1071A possibly damaging Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Ube2j1 T A 4: 33,049,943 F257I possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Wwp1 T C 4: 19,638,618 D575G probably damaging Het
Other mutations in Srebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL00774:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL01824:Srebf1 APN 11 60204131 missense probably benign 0.01
IGL02097:Srebf1 APN 11 60202824 missense probably damaging 1.00
IGL02808:Srebf1 APN 11 60201713 critical splice acceptor site probably null
IGL03036:Srebf1 APN 11 60220458 missense possibly damaging 0.85
IGL03055:Srebf1 UTSW 11 60207076 synonymous silent
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0550:Srebf1 UTSW 11 60201676 missense probably benign 0.00
R0654:Srebf1 UTSW 11 60204116 missense probably benign
R0707:Srebf1 UTSW 11 60204116 missense probably benign
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1584:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1899:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1900:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1905:Srebf1 UTSW 11 60204493 missense probably damaging 1.00
R2172:Srebf1 UTSW 11 60206502 missense probably benign
R2191:Srebf1 UTSW 11 60220539 missense probably damaging 1.00
R2268:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R5511:Srebf1 UTSW 11 60210358 utr 5 prime probably benign
R5841:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R5870:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R6003:Srebf1 UTSW 11 60207104 missense possibly damaging 0.82
R6371:Srebf1 UTSW 11 60203515 missense probably damaging 1.00
R6376:Srebf1 UTSW 11 60203535 missense probably null 0.19
R7009:Srebf1 UTSW 11 60200526 missense probably damaging 1.00
R7029:Srebf1 UTSW 11 60206984 missense probably damaging 1.00
R7410:Srebf1 UTSW 11 60205867 missense probably benign 0.03
R7569:Srebf1 UTSW 11 60200121 missense possibly damaging 0.69
R8317:Srebf1 UTSW 11 60200657 missense possibly damaging 0.62
R8370:Srebf1 UTSW 11 60202196 missense probably benign
R8871:Srebf1 UTSW 11 60200769 missense probably benign
RF009:Srebf1 UTSW 11 60204116 missense probably benign
X0017:Srebf1 UTSW 11 60202881 missense probably damaging 0.96
X0025:Srebf1 UTSW 11 60203427 missense probably benign 0.00
Z1176:Srebf1 UTSW 11 60207156 missense possibly damaging 0.95
Z1186:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1187:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1188:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1189:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1190:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1191:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1192:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-16