Incidental Mutation 'R2267:Mrc2'
ID242155
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 040267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2267 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105348431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8b G A 11: 109,955,148 T820M probably benign Het
Acot2 C T 12: 83,990,560 A216V probably damaging Het
Agap2 T A 10: 127,082,428 probably benign Het
Ak7 T C 12: 105,747,214 V419A probably benign Het
Apmap A G 2: 150,588,901 probably null Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Cachd1 T A 4: 100,949,069 probably benign Het
Ccdc39 T A 3: 33,815,484 E731D probably damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dgcr14 T C 16: 17,909,995 T107A probably damaging Het
Dgke T A 11: 89,052,469 E231D probably benign Het
Dhrs9 A G 2: 69,392,853 probably benign Het
Dhx30 C T 9: 110,087,034 G662R probably damaging Het
Dnah7b T A 1: 46,233,915 M2401K probably damaging Het
Dnmt3a T A 12: 3,897,551 probably null Het
Dst C T 1: 34,295,466 T4874I probably damaging Het
Eef2kmt G A 16: 5,255,940 probably benign Het
Etfa A T 9: 55,486,731 L212Q probably damaging Het
Exosc5 T C 7: 25,664,384 L107P possibly damaging Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fam186b T G 15: 99,285,643 D40A probably damaging Het
Fga T C 3: 83,032,950 L637P probably damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gcc1 A G 6: 28,418,499 S612P probably benign Het
Gjd3 C T 11: 98,982,401 V206M probably damaging Het
Gpam A T 19: 55,072,710 probably null Het
Gpc6 A T 14: 117,888,520 probably null Het
Gphb5 C G 12: 75,412,946 V92L probably benign Het
Grid2ip C T 5: 143,386,092 P690L probably benign Het
Gsdmc T C 15: 63,776,798 E429G probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hist1h2bh T C 13: 23,542,992 K121E possibly damaging Het
Hmcn1 T C 1: 150,599,010 S4709G probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnt2 G A 1: 140,573,683 probably null Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Klrb1 A T 6: 128,722,974 S25T probably damaging Het
L3mbtl3 C T 10: 26,331,857 W321* probably null Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrtm1 C A 6: 77,244,013 A151E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mcc T C 18: 44,519,541 D272G probably damaging Het
Mgst3 T A 1: 167,373,799 T106S probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mlh3 G T 12: 85,260,811 H1181N possibly damaging Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mro T C 18: 73,873,297 I104T probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Neurod2 C A 11: 98,327,756 C194F probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Nup205 T C 6: 35,241,349 S1819P possibly damaging Het
Obsl1 T C 1: 75,505,698 H176R probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr836 A T 9: 19,121,441 H162L probably benign Het
Olfr926 A G 9: 38,878,063 T296A probably benign Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Plxnd1 A G 6: 115,962,743 V1425A probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Ptpn12 A T 5: 20,998,411 N456K probably damaging Het
Scarb1 A T 5: 125,287,375 S97T possibly damaging Het
Scyl1 C T 19: 5,761,721 D440N possibly damaging Het
Sema5a C A 15: 32,574,919 T391K probably benign Het
Sipa1l3 T A 7: 29,399,602 N414I probably damaging Het
Skint6 T C 4: 112,842,822 probably null Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spib T A 7: 44,528,924 M141L probably benign Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Taf15 T G 11: 83,497,262 S200R probably damaging Het
Tanc1 G A 2: 59,837,219 probably null Het
Tas2r134 A G 2: 51,628,237 T243A probably benign Het
Tatdn1 A T 15: 58,905,752 M218K probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmprss11d A G 5: 86,373,349 Y2H probably benign Het
Trps1 G A 15: 50,822,398 R544C probably damaging Het
Ttc22 T C 4: 106,639,085 V444A possibly damaging Het
Ttc28 A G 5: 111,226,003 T1071A possibly damaging Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Ube2j1 T A 4: 33,049,943 F257I possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Wwp1 T C 4: 19,638,618 D575G probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTGCACTTGAGCTGCCAG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On2014-10-16