Mutagenetix > Incidental Mutation

Incidental Mutation 'R2267:Abca8b'

242156

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

040267-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2267 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 109955148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 820 (T820M)

Ref Sequence

ENSEMBL: ENSMUSP00000102280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably benign
Transcript: ENSMUST00000020948
AA Change: T882M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: T882M

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106669
AA Change: T820M

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: T820M

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (108/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578C19Rik	A	G	X: 18,423,687	S179P	possibly damaging	Het
Aadac	T	A	3: 60,037,316	D136E	probably damaging	Het
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Acot2	C	T	12: 83,990,560	A216V	probably damaging	Het
Agap2	T	A	10: 127,082,428		probably benign	Het
Ak7	T	C	12: 105,747,214	V419A	probably benign	Het
Apmap	A	G	2: 150,588,901		probably null	Het
Apob	T	C	12: 8,015,475	F4115S	possibly damaging	Het
Cachd1	T	A	4: 100,949,069		probably benign	Het
Ccdc39	T	A	3: 33,815,484	E731D	probably damaging	Het
Ces2a	A	T	8: 104,740,190	I65F	probably benign	Het
Commd8	A	G	5: 72,165,422	W51R	probably damaging	Het
D2hgdh	C	T	1: 93,835,435	A314V	probably damaging	Het
Dcun1d4	T	A	5: 73,481,275		probably benign	Het
Dgcr14	T	C	16: 17,909,995	T107A	probably damaging	Het
Dgke	T	A	11: 89,052,469	E231D	probably benign	Het
Dhrs9	A	G	2: 69,392,853		probably benign	Het
Dhx30	C	T	9: 110,087,034	G662R	probably damaging	Het
Dnah7b	T	A	1: 46,233,915	M2401K	probably damaging	Het
Dnmt3a	T	A	12: 3,897,551		probably null	Het
Dst	C	T	1: 34,295,466	T4874I	probably damaging	Het
Eef2kmt	G	A	16: 5,255,940		probably benign	Het
Etfa	A	T	9: 55,486,731	L212Q	probably damaging	Het
Exosc5	T	C	7: 25,664,384	L107P	possibly damaging	Het
Fam117b	T	C	1: 59,913,630	L156P	probably damaging	Het
Fam186b	T	G	15: 99,285,643	D40A	probably damaging	Het
Fga	T	C	3: 83,032,950	L637P	probably damaging	Het
Foxn4	T	C	5: 114,255,601	T486A	probably damaging	Het
Gcc1	A	G	6: 28,418,499	S612P	probably benign	Het
Gjd3	C	T	11: 98,982,401	V206M	probably damaging	Het
Gpam	A	T	19: 55,072,710		probably null	Het
Gpc6	A	T	14: 117,888,520		probably null	Het
Gphb5	C	G	12: 75,412,946	V92L	probably benign	Het
Grid2ip	C	T	5: 143,386,092	P690L	probably benign	Het
Gsdmc	T	C	15: 63,776,798	E429G	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hist1h2bh	T	C	13: 23,542,992	K121E	possibly damaging	Het
Hmcn1	T	C	1: 150,599,010	S4709G	probably benign	Het
Hr	A	T	14: 70,558,107	D393V	probably benign	Het
Ido2	T	C	8: 24,535,252	Y253C	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Itih4	A	G	14: 30,892,428	D445G	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kcnt2	G	A	1: 140,573,683		probably null	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Klrb1	A	T	6: 128,722,974	S25T	probably damaging	Het
L3mbtl3	C	T	10: 26,331,857	W321*	probably null	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lrrtm1	C	A	6: 77,244,013	A151E	probably damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Magi3	G	A	3: 104,021,066		probably benign	Het
Mamdc2	A	T	19: 23,303,903		probably benign	Het
Mcc	T	C	18: 44,519,541	D272G	probably damaging	Het
Mgst3	T	A	1: 167,373,799	T106S	probably benign	Het
Mink1	G	A	11: 70,601,724		probably null	Het
Mlh3	G	T	12: 85,260,811	H1181N	possibly damaging	Het
Mmrn2	A	G	14: 34,399,492	K773R	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mro	T	C	18: 73,873,297	I104T	probably benign	Het
Mtbp	G	A	15: 55,569,160		probably null	Het
Mtss1l	A	G	8: 110,728,730	K92E	possibly damaging	Het
Mybphl	A	G	3: 108,365,001	E2G	probably damaging	Het
Nbeal1	T	A	1: 60,330,878		probably benign	Het
Neurod2	C	A	11: 98,327,756	C194F	probably damaging	Het
Nr4a2	T	A	2: 57,112,006	D145V	possibly damaging	Het
Ntmt1	C	A	2: 30,820,460	N58K	probably benign	Het
Nup205	T	C	6: 35,241,349	S1819P	possibly damaging	Het
Obsl1	T	C	1: 75,505,698	H176R	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Olfr836	A	T	9: 19,121,441	H162L	probably benign	Het
Olfr926	A	G	9: 38,878,063	T296A	probably benign	Het
P2ry13	T	C	3: 59,210,028	M110V	probably damaging	Het
P2ry14	T	C	3: 59,115,571	N165S	probably damaging	Het
Phka1	A	G	X: 102,541,110		probably benign	Het
Plxnd1	A	G	6: 115,962,743	V1425A	probably benign	Het
Ppp2ca	G	A	11: 52,118,086	G138R	probably damaging	Het
Ptpn12	A	T	5: 20,998,411	N456K	probably damaging	Het
Scarb1	A	T	5: 125,287,375	S97T	possibly damaging	Het
Scyl1	C	T	19: 5,761,721	D440N	possibly damaging	Het
Sema5a	C	A	15: 32,574,919	T391K	probably benign	Het
Sipa1l3	T	A	7: 29,399,602	N414I	probably damaging	Het
Skint6	T	C	4: 112,842,822		probably null	Het
Slc35a3	T	C	3: 116,673,636	K325E	possibly damaging	Het
Spag17	C	A	3: 100,061,866		probably null	Het
Spib	T	A	7: 44,528,924	M141L	probably benign	Het
Srebf1	A	G	11: 60,207,147	S44P	probably damaging	Het
Styk1	T	C	6: 131,312,576	E25G	probably benign	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Taf15	T	G	11: 83,497,262	S200R	probably damaging	Het
Tanc1	G	A	2: 59,837,219		probably null	Het
Tas2r134	A	G	2: 51,628,237	T243A	probably benign	Het
Tatdn1	A	T	15: 58,905,752	M218K	probably damaging	Het
Tbc1d14	A	G	5: 36,543,217	L269P	possibly damaging	Het
Tbx1	T	C	16: 18,581,994		probably null	Het
Tgfbr3l	A	G	8: 4,250,506	E228G	probably benign	Het
Tmem233	G	C	5: 116,051,458		probably benign	Het
Tmprss11d	A	G	5: 86,373,349	Y2H	probably benign	Het
Trps1	G	A	15: 50,822,398	R544C	probably damaging	Het
Ttc22	T	C	4: 106,639,085	V444A	possibly damaging	Het
Ttc28	A	G	5: 111,226,003	T1071A	possibly damaging	Het
Tymp	A	T	15: 89,373,808	V378D	probably damaging	Het
Ube2j1	T	A	4: 33,049,943	F257I	possibly damaging	Het
Vmn2r18	T	C	5: 151,586,662	E82G	probably damaging	Het
Wwp1	T	C	4: 19,638,618	D575G	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9002:Abca8b	UTSW	11	109952630	missense	probably benign	0.02
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTGCCCAGCACTTTCAGAATG -3'
(R):5'- TGTCCCCTCAAATTTAGAAGTGAG -3'

Sequencing Primer
(F):5'- CCAGCACTTTCAGAATGAAACATAG -3'
(R):5'- CACATGGTGGCTCATGACTATCTAG -3'

Posted On

2014-10-16