Mutagenetix > Incidental Mutation

Incidental Mutation 'R2267:Hr'

242170

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000022096

Gene Name

hairless

Synonyms

ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino

MMRRC Submission

040267-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2267 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70552212-70573548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70558107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 393 (D393V)

Ref Sequence

ENSEMBL: ENSMUSP00000124042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]

AlphaFold

Q61645

Predicted Effect

probably benign
Transcript: ENSMUST00000022691
AA Change: D364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: D364V

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159959

Predicted Effect

probably benign
Transcript: ENSMUST00000161069
AA Change: D364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: D364V

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161468

Predicted Effect

probably benign
Transcript: ENSMUST00000163060
AA Change: D393V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: D393V

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (108/110)

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578C19Rik	A	G	X: 18,423,687	S179P	possibly damaging	Het
Aadac	T	A	3: 60,037,316	D136E	probably damaging	Het
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Abca8b	G	A	11: 109,955,148	T820M	probably benign	Het
Acot2	C	T	12: 83,990,560	A216V	probably damaging	Het
Agap2	T	A	10: 127,082,428		probably benign	Het
Ak7	T	C	12: 105,747,214	V419A	probably benign	Het
Apmap	A	G	2: 150,588,901		probably null	Het
Apob	T	C	12: 8,015,475	F4115S	possibly damaging	Het
Cachd1	T	A	4: 100,949,069		probably benign	Het
Ccdc39	T	A	3: 33,815,484	E731D	probably damaging	Het
Ces2a	A	T	8: 104,740,190	I65F	probably benign	Het
Commd8	A	G	5: 72,165,422	W51R	probably damaging	Het
D2hgdh	C	T	1: 93,835,435	A314V	probably damaging	Het
Dcun1d4	T	A	5: 73,481,275		probably benign	Het
Dgcr14	T	C	16: 17,909,995	T107A	probably damaging	Het
Dgke	T	A	11: 89,052,469	E231D	probably benign	Het
Dhrs9	A	G	2: 69,392,853		probably benign	Het
Dhx30	C	T	9: 110,087,034	G662R	probably damaging	Het
Dnah7b	T	A	1: 46,233,915	M2401K	probably damaging	Het
Dnmt3a	T	A	12: 3,897,551		probably null	Het
Dst	C	T	1: 34,295,466	T4874I	probably damaging	Het
Eef2kmt	G	A	16: 5,255,940		probably benign	Het
Etfa	A	T	9: 55,486,731	L212Q	probably damaging	Het
Exosc5	T	C	7: 25,664,384	L107P	possibly damaging	Het
Fam117b	T	C	1: 59,913,630	L156P	probably damaging	Het
Fam186b	T	G	15: 99,285,643	D40A	probably damaging	Het
Fga	T	C	3: 83,032,950	L637P	probably damaging	Het
Foxn4	T	C	5: 114,255,601	T486A	probably damaging	Het
Gcc1	A	G	6: 28,418,499	S612P	probably benign	Het
Gjd3	C	T	11: 98,982,401	V206M	probably damaging	Het
Gpam	A	T	19: 55,072,710		probably null	Het
Gpc6	A	T	14: 117,888,520		probably null	Het
Gphb5	C	G	12: 75,412,946	V92L	probably benign	Het
Grid2ip	C	T	5: 143,386,092	P690L	probably benign	Het
Gsdmc	T	C	15: 63,776,798	E429G	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hist1h2bh	T	C	13: 23,542,992	K121E	possibly damaging	Het
Hmcn1	T	C	1: 150,599,010	S4709G	probably benign	Het
Ido2	T	C	8: 24,535,252	Y253C	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Itih4	A	G	14: 30,892,428	D445G	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kcnt2	G	A	1: 140,573,683		probably null	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Klrb1	A	T	6: 128,722,974	S25T	probably damaging	Het
L3mbtl3	C	T	10: 26,331,857	W321*	probably null	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lrrtm1	C	A	6: 77,244,013	A151E	probably damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Magi3	G	A	3: 104,021,066		probably benign	Het
Mamdc2	A	T	19: 23,303,903		probably benign	Het
Mcc	T	C	18: 44,519,541	D272G	probably damaging	Het
Mgst3	T	A	1: 167,373,799	T106S	probably benign	Het
Mink1	G	A	11: 70,601,724		probably null	Het
Mlh3	G	T	12: 85,260,811	H1181N	possibly damaging	Het
Mmrn2	A	G	14: 34,399,492	K773R	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mro	T	C	18: 73,873,297	I104T	probably benign	Het
Mtbp	G	A	15: 55,569,160		probably null	Het
Mtss1l	A	G	8: 110,728,730	K92E	possibly damaging	Het
Mybphl	A	G	3: 108,365,001	E2G	probably damaging	Het
Nbeal1	T	A	1: 60,330,878		probably benign	Het
Neurod2	C	A	11: 98,327,756	C194F	probably damaging	Het
Nr4a2	T	A	2: 57,112,006	D145V	possibly damaging	Het
Ntmt1	C	A	2: 30,820,460	N58K	probably benign	Het
Nup205	T	C	6: 35,241,349	S1819P	possibly damaging	Het
Obsl1	T	C	1: 75,505,698	H176R	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Olfr836	A	T	9: 19,121,441	H162L	probably benign	Het
Olfr926	A	G	9: 38,878,063	T296A	probably benign	Het
P2ry13	T	C	3: 59,210,028	M110V	probably damaging	Het
P2ry14	T	C	3: 59,115,571	N165S	probably damaging	Het
Phka1	A	G	X: 102,541,110		probably benign	Het
Plxnd1	A	G	6: 115,962,743	V1425A	probably benign	Het
Ppp2ca	G	A	11: 52,118,086	G138R	probably damaging	Het
Ptpn12	A	T	5: 20,998,411	N456K	probably damaging	Het
Scarb1	A	T	5: 125,287,375	S97T	possibly damaging	Het
Scyl1	C	T	19: 5,761,721	D440N	possibly damaging	Het
Sema5a	C	A	15: 32,574,919	T391K	probably benign	Het
Sipa1l3	T	A	7: 29,399,602	N414I	probably damaging	Het
Skint6	T	C	4: 112,842,822		probably null	Het
Slc35a3	T	C	3: 116,673,636	K325E	possibly damaging	Het
Spag17	C	A	3: 100,061,866		probably null	Het
Spib	T	A	7: 44,528,924	M141L	probably benign	Het
Srebf1	A	G	11: 60,207,147	S44P	probably damaging	Het
Styk1	T	C	6: 131,312,576	E25G	probably benign	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Taf15	T	G	11: 83,497,262	S200R	probably damaging	Het
Tanc1	G	A	2: 59,837,219		probably null	Het
Tas2r134	A	G	2: 51,628,237	T243A	probably benign	Het
Tatdn1	A	T	15: 58,905,752	M218K	probably damaging	Het
Tbc1d14	A	G	5: 36,543,217	L269P	possibly damaging	Het
Tbx1	T	C	16: 18,581,994		probably null	Het
Tgfbr3l	A	G	8: 4,250,506	E228G	probably benign	Het
Tmem233	G	C	5: 116,051,458		probably benign	Het
Tmprss11d	A	G	5: 86,373,349	Y2H	probably benign	Het
Trps1	G	A	15: 50,822,398	R544C	probably damaging	Het
Ttc22	T	C	4: 106,639,085	V444A	possibly damaging	Het
Ttc28	A	G	5: 111,226,003	T1071A	possibly damaging	Het
Tymp	A	T	15: 89,373,808	V378D	probably damaging	Het
Ube2j1	T	A	4: 33,049,943	F257I	possibly damaging	Het
Vmn2r18	T	C	5: 151,586,662	E82G	probably damaging	Het
Wwp1	T	C	4: 19,638,618	D575G	probably damaging	Het

Other mutations in Hr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Hr	APN	14	70565297	splice site	probably benign
IGL02020:Hr	APN	14	70556437	missense	probably benign	0.01
IGL02372:Hr	APN	14	70558350	missense	possibly damaging	0.94
IGL02380:Hr	APN	14	70557761	missense	probably damaging	0.98
IGL02554:Hr	APN	14	70559866	splice site	probably benign
IGL02949:Hr	APN	14	70559785	missense	possibly damaging	0.87
IGL03406:Hr	APN	14	70563420	critical splice donor site	probably null
angie	UTSW	14	70567833	missense	probably damaging	0.97
blofeld	UTSW	14	70568085	missense	probably damaging	1.00
general	UTSW	14	70563684	critical splice donor site	probably null
kaburo	UTSW	14		unclassified
mister_clean	UTSW	14	70560064	critical splice donor site	probably benign
mushroom	UTSW	14	70568085	missense	probably damaging	1.00
prune	UTSW	14	70571429	missense	probably damaging	1.00
ren	UTSW	14	70568085	missense	probably damaging	1.00
subclinical	UTSW	14	70561836	missense	possibly damaging	0.89
vessel	UTSW	14	70561865	nonsense	probably null
yuanxiao	UTSW	14	70571448	missense	probably damaging	1.00
R0018:Hr	UTSW	14	70558277	missense	probably benign
R0038:Hr	UTSW	14	70568085	missense	probably damaging	1.00
R0374:Hr	UTSW	14	70556476	missense	probably benign	0.01
R0511:Hr	UTSW	14	70561912	nonsense	probably null
R0609:Hr	UTSW	14	70559657	missense	probably benign
R1828:Hr	UTSW	14	70572037	critical splice donor site	probably null
R2030:Hr	UTSW	14	70571448	missense	probably damaging	1.00
R2266:Hr	UTSW	14	70558107	missense	probably benign
R2268:Hr	UTSW	14	70558107	missense	probably benign
R2377:Hr	UTSW	14	70557878	missense	probably damaging	1.00
R3686:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3687:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3754:Hr	UTSW	14	70567824	missense	probably damaging	1.00
R3803:Hr	UTSW	14	70557893	missense	probably benign	0.01
R3846:Hr	UTSW	14	70571453	missense	probably damaging	1.00
R3977:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3978:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3979:Hr	UTSW	14	70563584	missense	probably benign	0.01
R4528:Hr	UTSW	14	70566383	missense	probably damaging	1.00
R4654:Hr	UTSW	14	70563573	missense	probably damaging	0.99
R4834:Hr	UTSW	14	70559922	missense	probably damaging	0.98
R4847:Hr	UTSW	14	70556476	missense	probably benign	0.04
R4863:Hr	UTSW	14	70571972	missense	probably damaging	1.00
R5292:Hr	UTSW	14	70571992	missense	probably damaging	1.00
R5452:Hr	UTSW	14	70556627	missense	probably damaging	1.00
R5717:Hr	UTSW	14	70566176	missense	probably benign	0.34
R5902:Hr	UTSW	14	70557791	missense	probably benign	0.02
R6000:Hr	UTSW	14	70567833	missense	probably damaging	0.97
R6439:Hr	UTSW	14	70561836	missense	possibly damaging	0.89
R6823:Hr	UTSW	14	70565374	missense	probably damaging	0.98
R7030:Hr	UTSW	14	70563684	critical splice donor site	probably null
R7213:Hr	UTSW	14	70558350	missense	probably damaging	0.99
R7452:Hr	UTSW	14	70571486	missense	probably damaging	1.00
R7468:Hr	UTSW	14	70558212	missense	possibly damaging	0.89
R7572:Hr	UTSW	14	70561853	missense	possibly damaging	0.66
R7956:Hr	UTSW	14	70559887	missense	probably benign
R7996:Hr	UTSW	14	70563603	nonsense	probably null
R7997:Hr	UTSW	14	70563603	nonsense	probably null
R8076:Hr	UTSW	14	70557941	missense	probably benign	0.00
R8101:Hr	UTSW	14	70567842	missense	possibly damaging	0.67
R8553:Hr	UTSW	14	70567525	missense	probably damaging	1.00
R8749:Hr	UTSW	14	70558070	missense	probably damaging	1.00
R8850:Hr	UTSW	14	70561865	nonsense	probably null
R8949:Hr	UTSW	14	70557888	missense	probably benign	0.01
R9139:Hr	UTSW	14	70557639	missense	possibly damaging	0.65
R9236:Hr	UTSW	14	70571956	missense	probably damaging	1.00
R9246:Hr	UTSW	14	70571475	missense	probably damaging	1.00
R9327:Hr	UTSW	14	70567788	missense	possibly damaging	0.91
R9337:Hr	UTSW	14	70559884	missense	probably benign	0.00
R9487:Hr	UTSW	14	70556437	missense	probably benign	0.01
R9487:Hr	UTSW	14	70556765	missense	possibly damaging	0.77
R9700:Hr	UTSW	14	70567176	missense	probably benign	0.00
X0025:Hr	UTSW	14	70566951	splice site	probably null
X0026:Hr	UTSW	14	70567841	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TACCCAGACACTGTTCCTCG -3'
(R):5'- TGATGCTCCTTGGACCTCTG -3'

Sequencing Primer
(F):5'- TGGTTCACAGTCTTGGCAAC -3'
(R):5'- TTGGACCTCTGGACTGCCTG -3'

Posted On

2014-10-16