Incidental Mutation 'R0167:St8sia1'
ID 24224
Institutional Source Beutler Lab
Gene Symbol St8sia1
Ensembl Gene ENSMUSG00000030283
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms GD3S, GD3 synthase, Siat8, ST8Sia I, alpha-2,8-sialyltransferase, Siat8a, 9330109E03Rik
MMRRC Submission 038443-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R0167 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 142767271-142910178 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 142859907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032421] [ENSMUST00000205149]
AlphaFold Q64687
Predicted Effect probably benign
Transcript: ENSMUST00000032421
SMART Domains Protein: ENSMUSP00000032421
Gene: ENSMUSG00000030283

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Glyco_transf_29 90 344 8.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205149
SMART Domains Protein: ENSMUSP00000145148
Gene: ENSMUSG00000030283

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted allele are behaviorally normal with no signs of aberrant brain histology or demyelination. Homozygotes for a knock-out allele are behaviorally intact with normal nervous tissue morphology and sensitivity to Fas-mediated apoptosis but show impaired repair of damaged nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,806,969 (GRCm39) F431L probably damaging Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Bltp3a C T 17: 28,099,176 (GRCm39) T246M possibly damaging Het
Bsn T C 9: 108,003,185 (GRCm39) T407A probably benign Het
Ccdc96 T C 5: 36,642,497 (GRCm39) F168L probably benign Het
Cckar A T 5: 53,863,795 (GRCm39) S55R probably damaging Het
Cdh5 A C 8: 104,863,367 (GRCm39) I426L possibly damaging Het
Clcn1 T C 6: 42,263,770 (GRCm39) Y24H probably damaging Het
Clpx G A 9: 65,224,019 (GRCm39) R271K possibly damaging Het
Col6a3 C T 1: 90,725,895 (GRCm39) G1978D probably damaging Het
Cpne2 T C 8: 95,295,207 (GRCm39) probably benign Het
D630023F18Rik A G 1: 65,156,340 (GRCm39) V51A possibly damaging Het
Dcaf4 G A 12: 83,582,762 (GRCm39) probably benign Het
Dlk2 C A 17: 46,613,530 (GRCm39) R262S possibly damaging Het
Dubr G T 16: 50,553,007 (GRCm39) noncoding transcript Het
Elane T A 10: 79,722,933 (GRCm39) probably null Het
Eya2 T G 2: 165,558,032 (GRCm39) S209R possibly damaging Het
Fam171a1 C T 2: 3,187,469 (GRCm39) S112L probably damaging Het
Fsip2 T A 2: 82,811,151 (GRCm39) M2490K possibly damaging Het
Galnt14 T C 17: 73,829,715 (GRCm39) T277A probably damaging Het
Golga1 T C 2: 38,937,660 (GRCm39) N128S probably benign Het
H1f6 T C 13: 23,879,886 (GRCm39) V13A probably benign Het
Hdac2 T C 10: 36,876,368 (GRCm39) V461A probably benign Het
Hey2 A G 10: 30,716,661 (GRCm39) V34A probably benign Het
Ift22 T C 5: 136,940,745 (GRCm39) C137R probably benign Het
Lrp2 T C 2: 69,256,002 (GRCm39) D4657G possibly damaging Het
Lrrn3 T A 12: 41,504,014 (GRCm39) Q101L probably damaging Het
Med25 A G 7: 44,532,521 (GRCm39) probably null Het
Mup5 T A 4: 61,752,019 (GRCm39) probably null Het
Or51aa5 A T 7: 103,166,708 (GRCm39) Y294* probably null Het
Or5ac23 A T 16: 59,149,337 (GRCm39) C178* probably null Het
Or9q2 T C 19: 13,772,931 (GRCm39) T15A probably benign Het
Otog G A 7: 45,953,655 (GRCm39) V2638M probably damaging Het
Parg T C 14: 31,939,693 (GRCm39) probably null Het
Prep A G 10: 45,034,326 (GRCm39) probably null Het
Prss1l T A 6: 41,373,195 (GRCm39) probably benign Het
Psip1 T C 4: 83,385,055 (GRCm39) probably null Het
Rbbp8 T A 18: 11,793,979 (GRCm39) Y30* probably null Het
Rhbdd1 T C 1: 82,320,505 (GRCm39) V163A probably benign Het
Setd2 T A 9: 110,402,850 (GRCm39) N1830K probably damaging Het
Shc4 T G 2: 125,564,933 (GRCm39) N122T probably benign Het
Shroom3 T C 5: 93,096,254 (GRCm39) probably benign Het
Snx14 A T 9: 88,289,469 (GRCm39) L261Q probably damaging Het
Thbs2 A T 17: 14,887,787 (GRCm39) probably benign Het
Tpp2 T C 1: 44,009,648 (GRCm39) V494A probably benign Het
Trdmt1 A T 2: 13,520,829 (GRCm39) F358I probably damaging Het
Ttn T A 2: 76,719,867 (GRCm39) probably benign Het
Uggt1 A G 1: 36,209,278 (GRCm39) probably null Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vstm2a T A 11: 16,208,044 (GRCm39) F13I probably damaging Het
Zfp804a T G 2: 82,086,860 (GRCm39) F230V probably damaging Het
Other mutations in St8sia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:St8sia1 APN 6 142,774,953 (GRCm39) missense probably benign 0.00
IGL02138:St8sia1 APN 6 142,909,504 (GRCm39) utr 5 prime probably benign
IGL02419:St8sia1 APN 6 142,774,661 (GRCm39) missense probably damaging 1.00
IGL03407:St8sia1 APN 6 142,859,775 (GRCm39) missense possibly damaging 0.80
PIT4453001:St8sia1 UTSW 6 142,774,978 (GRCm39) nonsense probably null
PIT4498001:St8sia1 UTSW 6 142,859,848 (GRCm39) missense probably damaging 1.00
R0690:St8sia1 UTSW 6 142,774,980 (GRCm39) missense probably damaging 1.00
R1727:St8sia1 UTSW 6 142,822,453 (GRCm39) missense probably damaging 0.99
R1743:St8sia1 UTSW 6 142,774,742 (GRCm39) missense probably damaging 1.00
R1937:St8sia1 UTSW 6 142,909,398 (GRCm39) missense probably damaging 1.00
R2923:St8sia1 UTSW 6 142,774,963 (GRCm39) missense probably damaging 1.00
R2983:St8sia1 UTSW 6 142,909,355 (GRCm39) missense probably damaging 0.99
R3824:St8sia1 UTSW 6 142,774,751 (GRCm39) missense probably damaging 1.00
R4803:St8sia1 UTSW 6 142,813,649 (GRCm39) missense probably benign 0.04
R4844:St8sia1 UTSW 6 142,774,996 (GRCm39) missense possibly damaging 0.82
R4865:St8sia1 UTSW 6 142,774,796 (GRCm39) missense probably damaging 1.00
R4886:St8sia1 UTSW 6 142,859,860 (GRCm39) missense probably damaging 0.99
R5170:St8sia1 UTSW 6 142,909,434 (GRCm39) missense probably damaging 0.99
R5519:St8sia1 UTSW 6 142,909,287 (GRCm39) missense probably damaging 0.99
R5783:St8sia1 UTSW 6 142,909,340 (GRCm39) missense possibly damaging 0.83
R6713:St8sia1 UTSW 6 142,775,008 (GRCm39) splice site probably null
R7017:St8sia1 UTSW 6 142,813,632 (GRCm39) missense probably damaging 0.98
R7144:St8sia1 UTSW 6 142,822,395 (GRCm39) missense probably damaging 1.00
R7997:St8sia1 UTSW 6 142,909,376 (GRCm39) missense probably damaging 1.00
Z1176:St8sia1 UTSW 6 142,774,825 (GRCm39) missense probably damaging 1.00
Z1177:St8sia1 UTSW 6 142,774,536 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGCCTCAAAGCAGGAAACATGG -3'
(R):5'- AAAGCCTAGTTGCCCTTCAGAGCC -3'

Sequencing Primer
(F):5'- TCCTATCAGTCGTGAGAAACAG -3'
(R):5'- ATGGCTGGACTAATCCATGC -3'
Posted On 2013-04-16