Incidental Mutation 'R2268:Acox2'
ID242257
Institutional Source Beutler Lab
Gene Symbol Acox2
Ensembl Gene ENSMUSG00000021751
Gene Nameacyl-Coenzyme A oxidase 2, branched chain
Synonyms
MMRRC Submission 040268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R2268 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8225511-8259353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8253496 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 217 (M217K)
Ref Sequence ENSEMBL: ENSMUSP00000126464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598] [ENSMUST00000170534]
Predicted Effect probably damaging
Transcript: ENSMUST00000022271
AA Change: M217K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: M217K

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164412
Predicted Effect probably damaging
Transcript: ENSMUST00000164598
AA Change: M217K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: M217K

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170534
SMART Domains Protein: ENSMUSP00000130543
Gene: ENSMUSG00000021751

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 4.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171567
Meta Mutation Damage Score 0.5433 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Adam34 C T 8: 43,650,610 R666H probably benign Het
Adap2 G T 11: 80,165,726 Q188H probably damaging Het
Adgrb3 T C 1: 25,111,817 T872A possibly damaging Het
Ahnak A G 19: 9,010,574 K3074R possibly damaging Het
Ano7 A T 1: 93,380,439 D64V possibly damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Arl13a A G X: 134,205,413 Q236R possibly damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Atn1 C G 6: 124,746,240 probably benign Het
Ccser1 C T 6: 61,570,843 T118M probably damaging Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Col17a1 G A 19: 47,650,111 P1173S probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp4f17 G T 17: 32,517,954 V87F probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dhodh A G 8: 109,594,674 F360S possibly damaging Het
Dynap C T 18: 70,241,147 A103T probably benign Het
Edem2 G A 2: 155,702,217 P538S probably benign Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Erich6 A T 3: 58,618,839 S581T probably benign Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Fzd9 A G 5: 135,250,294 S246P probably damaging Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hmcn1 A G 1: 150,624,598 probably benign Het
Hps3 G A 3: 20,012,935 probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Irs2 T C 8: 11,007,586 E282G probably damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kif14 T A 1: 136,519,748 C1430* probably null Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lamb1 A T 12: 31,327,645 I1630F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtbp G A 15: 55,569,160 probably null Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Myoc C T 1: 162,649,056 T443M probably damaging Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr906 T A 9: 38,488,208 Y60N probably damaging Het
Opcml T C 9: 28,903,355 I301T possibly damaging Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rdh7 A G 10: 127,884,661 S281P probably benign Het
Rps17 C T 7: 81,344,998 R5H probably benign Het
Scgb1b2 T A 7: 31,291,776 probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Snap23 A G 2: 120,599,312 T213A probably benign Het
Spag17 C A 3: 100,061,866 probably null Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
St8sia5 T C 18: 77,232,830 S93P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbc1d22b A G 17: 29,599,854 H394R probably damaging Het
Tbx5 A T 5: 119,845,109 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Ttc37 T G 13: 76,112,274 probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vangl1 A T 3: 102,196,844 Y7N probably damaging Het
Vav2 A T 2: 27,292,655 probably null Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r15 A G 5: 109,293,207 Y262H probably benign Het
Vmn2r76 T C 7: 86,230,499 M198V probably benign Het
Zfp831 A C 2: 174,644,241 R236S probably benign Het
Other mutations in Acox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Acox2 APN 14 8246363 missense probably damaging 1.00
IGL01845:Acox2 APN 14 8251617 missense probably damaging 1.00
IGL02830:Acox2 APN 14 8255298 missense probably damaging 1.00
R0415:Acox2 UTSW 14 8243835 splice site probably benign
R0535:Acox2 UTSW 14 8256753 missense probably damaging 1.00
R1424:Acox2 UTSW 14 8230247 missense probably benign 0.02
R1836:Acox2 UTSW 14 8248059 missense possibly damaging 0.91
R1862:Acox2 UTSW 14 8241416 missense probably benign 0.07
R1885:Acox2 UTSW 14 8248102 missense probably benign 0.00
R2032:Acox2 UTSW 14 8246400 missense probably benign 0.00
R2497:Acox2 UTSW 14 8251612 missense probably benign 0.00
R3032:Acox2 UTSW 14 8253466 missense probably damaging 1.00
R3842:Acox2 UTSW 14 8251543 missense probably damaging 1.00
R3874:Acox2 UTSW 14 8248061 missense probably benign 0.00
R4763:Acox2 UTSW 14 8241334 missense possibly damaging 0.81
R5072:Acox2 UTSW 14 8241374 nonsense probably null
R5397:Acox2 UTSW 14 8243803 missense probably benign 0.02
R5950:Acox2 UTSW 14 8255793 missense probably benign
R7188:Acox2 UTSW 14 8252996 missense possibly damaging 0.67
R7208:Acox2 UTSW 14 8241303 missense probably benign 0.27
R7315:Acox2 UTSW 14 8256139 missense probably damaging 0.99
R7757:Acox2 UTSW 14 8230166 missense probably damaging 1.00
R7888:Acox2 UTSW 14 8246415 missense probably benign 0.00
R8269:Acox2 UTSW 14 8246325 missense probably benign 0.00
R8531:Acox2 UTSW 14 8247960 missense probably damaging 1.00
R8536:Acox2 UTSW 14 8256081 missense probably benign 0.00
R8782:Acox2 UTSW 14 8250035 missense probably damaging 0.99
R8964:Acox2 UTSW 14 8243768 nonsense probably null
Z1177:Acox2 UTSW 14 8256852 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTGAAGTCAGACAGATGC -3'
(R):5'- ACTTTCCAAGGACCCAAAGG -3'

Sequencing Primer
(F):5'- GACAGATGCTGAATCTTATACCAGTC -3'
(R):5'- TTCCAAGGACCCAAAGGCATCTATC -3'
Posted On2014-10-16