Incidental Mutation 'R2268:Tymp'
ID242262
Institutional Source Beutler Lab
Gene Symbol Tymp
Ensembl Gene ENSMUSG00000022615
Gene Namethymidine phosphorylase
Synonyms2900072D10Rik, PD-ECGF, gliostatin, Pdgfec, PDECGF, Ecgf1
MMRRC Submission 040268-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2268 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89371931-89377039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89373808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 378 (V378D)
Ref Sequence ENSEMBL: ENSMUSP00000023285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000049968] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000227834] [ENSMUST00000228111] [ENSMUST00000228977]
Predicted Effect probably damaging
Transcript: ENSMUST00000023285
AA Change: V378D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615
AA Change: V378D

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049968
SMART Domains Protein: ENSMUSP00000053112
Gene: ENSMUSG00000047394

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 24 60 1.4e-4 PFAM
Pfam:SHIPPO-rpt 101 129 1.6e-3 PFAM
Pfam:SHIPPO-rpt 138 172 2.7e-6 PFAM
Pfam:SHIPPO-rpt 181 211 2.5e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140665
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151523
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227203
Predicted Effect probably benign
Transcript: ENSMUST00000227834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228005
Predicted Effect probably benign
Transcript: ENSMUST00000228111
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Meta Mutation Damage Score 0.4769 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced thymidine phosphorylase activity and increased thymidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Acox2 A T 14: 8,253,496 M217K probably damaging Het
Adam34 C T 8: 43,650,610 R666H probably benign Het
Adap2 G T 11: 80,165,726 Q188H probably damaging Het
Adgrb3 T C 1: 25,111,817 T872A possibly damaging Het
Ahnak A G 19: 9,010,574 K3074R possibly damaging Het
Ano7 A T 1: 93,380,439 D64V possibly damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Arl13a A G X: 134,205,413 Q236R possibly damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Atn1 C G 6: 124,746,240 probably benign Het
Ccser1 C T 6: 61,570,843 T118M probably damaging Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Col17a1 G A 19: 47,650,111 P1173S probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp4f17 G T 17: 32,517,954 V87F probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dhodh A G 8: 109,594,674 F360S possibly damaging Het
Dynap C T 18: 70,241,147 A103T probably benign Het
Edem2 G A 2: 155,702,217 P538S probably benign Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Erich6 A T 3: 58,618,839 S581T probably benign Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Fzd9 A G 5: 135,250,294 S246P probably damaging Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hmcn1 A G 1: 150,624,598 probably benign Het
Hps3 G A 3: 20,012,935 probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Irs2 T C 8: 11,007,586 E282G probably damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kif14 T A 1: 136,519,748 C1430* probably null Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lamb1 A T 12: 31,327,645 I1630F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtbp G A 15: 55,569,160 probably null Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Myoc C T 1: 162,649,056 T443M probably damaging Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr906 T A 9: 38,488,208 Y60N probably damaging Het
Opcml T C 9: 28,903,355 I301T possibly damaging Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rdh7 A G 10: 127,884,661 S281P probably benign Het
Rps17 C T 7: 81,344,998 R5H probably benign Het
Scgb1b2 T A 7: 31,291,776 probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Snap23 A G 2: 120,599,312 T213A probably benign Het
Spag17 C A 3: 100,061,866 probably null Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
St8sia5 T C 18: 77,232,830 S93P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbc1d22b A G 17: 29,599,854 H394R probably damaging Het
Tbx5 A T 5: 119,845,109 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Ttc37 T G 13: 76,112,274 probably benign Het
Vangl1 A T 3: 102,196,844 Y7N probably damaging Het
Vav2 A T 2: 27,292,655 probably null Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r15 A G 5: 109,293,207 Y262H probably benign Het
Vmn2r76 T C 7: 86,230,499 M198V probably benign Het
Zfp831 A C 2: 174,644,241 R236S probably benign Het
Other mutations in Tymp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Tymp APN 15 89376310 missense probably damaging 1.00
IGL03355:Tymp APN 15 89375016 missense possibly damaging 0.80
PIT4142001:Tymp UTSW 15 89376345 missense probably damaging 1.00
R0791:Tymp UTSW 15 89374818 missense probably damaging 1.00
R2219:Tymp UTSW 15 89374762 missense probably benign
R2266:Tymp UTSW 15 89373808 missense probably damaging 1.00
R2267:Tymp UTSW 15 89373808 missense probably damaging 1.00
R4714:Tymp UTSW 15 89376307 missense probably damaging 1.00
R5247:Tymp UTSW 15 89374364 frame shift probably null
R5248:Tymp UTSW 15 89374364 frame shift probably null
R5249:Tymp UTSW 15 89374364 frame shift probably null
R5741:Tymp UTSW 15 89376436 missense probably benign 0.18
R5810:Tymp UTSW 15 89374331 missense probably damaging 0.99
R5960:Tymp UTSW 15 89376575 critical splice donor site probably null
R6082:Tymp UTSW 15 89374364 frame shift probably null
R6083:Tymp UTSW 15 89374364 frame shift probably null
R6085:Tymp UTSW 15 89374364 frame shift probably null
R6566:Tymp UTSW 15 89373600 missense probably benign
R6869:Tymp UTSW 15 89376691 missense probably benign
R6969:Tymp UTSW 15 89374048 missense probably benign 0.04
R7019:Tymp UTSW 15 89376281 synonymous probably null
Z1177:Tymp UTSW 15 89375564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGATCTGATAGCACGAGC -3'
(R):5'- CCGGCCTAGCTAAAGCATTG -3'

Sequencing Primer
(F):5'- AGAGGCGGTTACCTAGGTCAC -3'
(R):5'- GCATTGTGCTCCGGGAG -3'
Posted On2014-10-16