Incidental Mutation 'R2268:Tbc1d22b'
ID 242263
Institutional Source Beutler Lab
Gene Symbol Tbc1d22b
Ensembl Gene ENSMUSG00000042203
Gene Name TBC1 domain family, member 22B
Synonyms
MMRRC Submission 040268-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R2268 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 29549788-29606895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29599854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 394 (H394R)
Ref Sequence ENSEMBL: ENSMUSP00000046877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048677]
AlphaFold Q80VE5
Predicted Effect probably damaging
Transcript: ENSMUST00000048677
AA Change: H394R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046877
Gene: ENSMUSG00000042203
AA Change: H394R

DomainStartEndE-ValueType
Blast:TBC 23 93 6e-12 BLAST
TBC 207 460 1.25e-56 SMART
Blast:TBC 464 504 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183866
Meta Mutation Damage Score 0.8360 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Acox2 A T 14: 8,253,496 M217K probably damaging Het
Adam34 C T 8: 43,650,610 R666H probably benign Het
Adap2 G T 11: 80,165,726 Q188H probably damaging Het
Adgrb3 T C 1: 25,111,817 T872A possibly damaging Het
Ahnak A G 19: 9,010,574 K3074R possibly damaging Het
Ano7 A T 1: 93,380,439 D64V possibly damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Arl13a A G X: 134,205,413 Q236R possibly damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Atn1 C G 6: 124,746,240 probably benign Het
Ccser1 C T 6: 61,570,843 T118M probably damaging Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Col17a1 G A 19: 47,650,111 P1173S probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp4f17 G T 17: 32,517,954 V87F probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dhodh A G 8: 109,594,674 F360S possibly damaging Het
Dynap C T 18: 70,241,147 A103T probably benign Het
Edem2 G A 2: 155,702,217 P538S probably benign Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Erich6 A T 3: 58,618,839 S581T probably benign Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Fzd9 A G 5: 135,250,294 S246P probably damaging Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hmcn1 A G 1: 150,624,598 probably benign Het
Hps3 G A 3: 20,012,935 probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Irs2 T C 8: 11,007,586 E282G probably damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kif14 T A 1: 136,519,748 C1430* probably null Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lamb1 A T 12: 31,327,645 I1630F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtbp G A 15: 55,569,160 probably null Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Myoc C T 1: 162,649,056 T443M probably damaging Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr906 T A 9: 38,488,208 Y60N probably damaging Het
Opcml T C 9: 28,903,355 I301T possibly damaging Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rdh7 A G 10: 127,884,661 S281P probably benign Het
Rps17 C T 7: 81,344,998 R5H probably benign Het
Scgb1b2 T A 7: 31,291,776 probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Snap23 A G 2: 120,599,312 T213A probably benign Het
Spag17 C A 3: 100,061,866 probably null Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
St8sia5 T C 18: 77,232,830 S93P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx5 A T 5: 119,845,109 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Ttc37 T G 13: 76,112,274 probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vangl1 A T 3: 102,196,844 Y7N probably damaging Het
Vav2 A T 2: 27,292,655 probably null Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r15 A G 5: 109,293,207 Y262H probably benign Het
Vmn2r76 T C 7: 86,230,499 M198V probably benign Het
Zfp831 A C 2: 174,644,241 R236S probably benign Het
Other mutations in Tbc1d22b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Tbc1d22b APN 17 29568598 missense possibly damaging 0.60
IGL01836:Tbc1d22b APN 17 29599958 missense probably damaging 1.00
R1524:Tbc1d22b UTSW 17 29570611 missense probably damaging 0.99
R1681:Tbc1d22b UTSW 17 29575177 missense possibly damaging 0.46
R1757:Tbc1d22b UTSW 17 29571673 missense probably damaging 1.00
R5656:Tbc1d22b UTSW 17 29594780 missense probably damaging 1.00
R5832:Tbc1d22b UTSW 17 29570647 missense possibly damaging 0.80
R6892:Tbc1d22b UTSW 17 29595890 missense possibly damaging 0.80
R7095:Tbc1d22b UTSW 17 29599869 missense probably damaging 0.96
R7780:Tbc1d22b UTSW 17 29573066 missense probably benign 0.06
R8121:Tbc1d22b UTSW 17 29572971 missense probably damaging 1.00
R8784:Tbc1d22b UTSW 17 29599944 missense probably damaging 1.00
R8964:Tbc1d22b UTSW 17 29600228 missense probably damaging 1.00
R9641:Tbc1d22b UTSW 17 29594773 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCATGGCCAGTGCATTGCC -3'
(R):5'- GGCTCAAGAGATTCCAAAGGC -3'

Sequencing Primer
(F):5'- CAGTGCATTGCCAGGATGG -3'
(R):5'- AGAGATTCCAAAGGCAGACAC -3'
Posted On 2014-10-16