Incidental Mutation 'R2269:Sh3bp4'
ID 242280
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 040269-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2269 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 89070415-89155068 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89145592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 721 (V721I)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect possibly damaging
Transcript: ENSMUST00000066279
AA Change: V721I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: V721I

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89143960 missense probably benign
IGL01344:Sh3bp4 APN 1 89153236 missense probably benign
IGL02025:Sh3bp4 APN 1 89145286 missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89143690 missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89145148 missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89153163 missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89143544 splice site probably benign
IGL03327:Sh3bp4 APN 1 89144163 nonsense probably null
I0000:Sh3bp4 UTSW 1 89137796 missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89145434 missense probably benign
R0128:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89143772 missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89145488 missense probably damaging 1.00
R3407:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89145328 missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89145869 missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89144273 missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89145595 missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89144240 missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89137734 missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89144275 missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89145350 missense probably benign
R5908:Sh3bp4 UTSW 1 89145883 missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89145489 missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89144921 missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89153166 missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89145767 missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89153102 splice site probably null
R7320:Sh3bp4 UTSW 1 89145494 missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89144448 missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89145646 missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89145315 missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89145575 missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89152342 missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89144437 missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89144925 nonsense probably null
R9718:Sh3bp4 UTSW 1 89145750 missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89145022 missense probably benign
Z1176:Sh3bp4 UTSW 1 89145728 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GTATCCAACGTTTCAGGACCG -3'
(R):5'- GTAACCCAGGGCATCAGCAAAG -3'

Sequencing Primer
(F):5'- CTTCTAAAGACAGTGGTGCGGC -3'
(R):5'- GCATCAGCAAAGGCCCG -3'
Posted On 2014-10-16