Mutagenetix > Incidental Mutations

Incidental Mutation 'R2269:Pappa2'

242284

Institutional Source

Beutler Lab

Gene Symbol

Pappa2

Ensembl Gene

ENSMUSG00000073530

Gene Name

pappalysin 2

Synonyms

pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe

MMRRC Submission

040269-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2269 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158711727-158980490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158857271 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 766 (M766T)

Ref Sequence

ENSEMBL: ENSMUSP00000124022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159861]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159861
AA Change: M766T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: M766T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Laminin_G_3	271	440	1.2e-25	PFAM
NL	572	614	2.81e-5	SMART
Pfam:Peptidase_M43	669	832	1.5e-12	PFAM
Blast:FN3	844	1103	1e-169	BLAST
low complexity region	1130	1139	N/A	INTRINSIC
low complexity region	1361	1370	N/A	INTRINSIC
CCP	1394	1457	4.97e0	SMART
CCP	1462	1519	4.81e-1	SMART
CCP	1523	1588	2.58e-4	SMART
CCP	1593	1644	1.13e0	SMART
NL	1720	1757	2.66e-6	SMART

Meta Mutation Damage Score

0.2658

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Abca8a	A	C	11: 110,026,892	F1574V	probably damaging	Het
Adh6a	A	T	3: 138,329,096	I329L	probably benign	Het
Agap2	T	A	10: 127,082,428		probably benign	Het
Ager	A	T	17: 34,599,150	I185F	probably damaging	Het
Agrn	C	T	4: 156,179,218	G173R	probably damaging	Het
Arhgef16	T	A	4: 154,285,033	H329L	probably damaging	Het
Astn1	T	C	1: 158,502,099	Y175H	probably damaging	Het
Banp	A	G	8: 121,975,923	T70A	probably benign	Het
Bcl11b	T	C	12: 107,915,651	T802A	possibly damaging	Het
Ces2a	A	T	8: 104,740,190	I65F	probably benign	Het
Cflar	G	A	1: 58,741,047		probably null	Het
Clec16a	G	A	16: 10,644,786	R656H	probably damaging	Het
Cntn1	A	G	15: 92,294,982		probably benign	Het
Coasy	A	G	11: 101,085,882	T493A	probably benign	Het
Col16a1	C	A	4: 130,052,918	H111Q	probably benign	Het
Commd8	A	G	5: 72,165,422	W51R	probably damaging	Het
Cyp3a41b	A	T	5: 145,578,166	V83D	probably benign	Het
D2hgdh	C	T	1: 93,835,435	A314V	probably damaging	Het
Dcun1d4	T	A	5: 73,481,275		probably benign	Het
Decr2	C	A	17: 26,083,884	V173L	probably benign	Het
Defb11	A	G	8: 21,905,428	*78Q	probably null	Het
Dock3	C	A	9: 106,941,326	V1190F	probably damaging	Het
Dusp1	A	T	17: 26,507,119	I200N	probably damaging	Het
Efna1	G	A	3: 89,276,339	A60V	possibly damaging	Het
Egfl8	C	T	17: 34,613,858	V253M	probably damaging	Het
Epb41	T	A	4: 131,964,147	N623I	probably benign	Het
Fbxw22	C	T	9: 109,383,994	R295K	probably benign	Het
Foxn4	T	C	5: 114,255,601	T486A	probably damaging	Het
Gbe1	C	T	16: 70,436,952	A239V	probably damaging	Het
Gpatch3	C	T	4: 133,583,807	A518V	possibly damaging	Het
Gpc6	A	T	14: 117,888,520		probably null	Het
Hdhd2	C	T	18: 76,965,170	T172M	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hnrnpul1	A	G	7: 25,750,874	Y138H	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Klhl31	A	G	9: 77,650,158	D52G	possibly damaging	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lrrc43	A	T	5: 123,503,291	T513S	probably damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mamdc2	A	T	19: 23,303,903		probably benign	Het
Mpdz	A	G	4: 81,383,391	S266P	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mroh5	T	C	15: 73,793,148	N258D	probably benign	Het
Mrpl28	T	C	17: 26,126,311	V235A	probably benign	Het
Mtbp	G	A	15: 55,569,160		probably null	Het
Mtss1l	A	G	8: 110,728,730	K92E	possibly damaging	Het
Muc4	C	A	16: 32,754,529	H1468N	probably benign	Het
Nav1	A	T	1: 135,472,236	L532*	probably null	Het
Olfr1330	A	T	4: 118,893,874	R264W	probably damaging	Het
Olfr382	A	G	11: 73,516,483	S239P	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Pkhd1	C	T	1: 20,534,535		probably null	Het
Plch2	T	C	4: 154,993,004	E423G	probably benign	Het
Prrc1	G	T	18: 57,381,646	D312Y	probably damaging	Het
Pxdn	T	A	12: 30,005,775	V1220E	probably damaging	Het
Robo1	T	A	16: 72,978,772	F728L	probably benign	Het
Rtel1	G	T	2: 181,336,003	Q292H	probably benign	Het
Sh3bp4	G	A	1: 89,145,592	V721I	possibly damaging	Het
Slc2a10	T	A	2: 165,514,781	C120*	probably null	Het
Srd5a2	T	C	17: 74,024,490	R171G	probably damaging	Het
Srsf4	T	C	4: 131,897,682	V130A	probably damaging	Het
Styk1	T	C	6: 131,312,576	E25G	probably benign	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Tbc1d14	A	G	5: 36,543,217	L269P	possibly damaging	Het
Tbx1	T	C	16: 18,581,994		probably null	Het
Tmem233	G	C	5: 116,051,458		probably benign	Het
Tmem252	T	C	19: 24,674,091	I8T	probably benign	Het
Vcp	G	A	4: 42,980,833	A759V	possibly damaging	Het
Vmn2r107	T	C	17: 20,375,555	I790T	possibly damaging	Het
Vmn2r77	T	C	7: 86,811,689	V741A	probably benign	Het
Vps13c	T	C	9: 67,920,947	V1461A	possibly damaging	Het
Ylpm1	T	A	12: 85,015,050	V575E	unknown	Het
Zbp1	T	A	2: 173,218,823		probably benign	Het
Zfp280d	C	A	9: 72,301,770		probably benign	Het
Zkscan5	A	G	5: 145,205,467	Y58C	probably damaging	Het

Other mutations in Pappa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Pappa2	APN	1	158857148	missense	probably damaging	1.00
IGL01394:Pappa2	APN	1	158765104	splice site	probably benign
IGL01570:Pappa2	APN	1	158814540	nonsense	probably null
IGL01618:Pappa2	APN	1	158857378	missense	probably damaging	1.00
IGL01717:Pappa2	APN	1	158857132	critical splice donor site	probably null
IGL01804:Pappa2	APN	1	158936519	missense	probably benign
IGL01904:Pappa2	APN	1	158783941	missense	probably damaging	0.99
IGL02116:Pappa2	APN	1	158845125	missense	probably benign	0.01
IGL02174:Pappa2	APN	1	158761618	missense	probably damaging	1.00
IGL02302:Pappa2	APN	1	158715001	missense	probably benign	0.38
IGL02422:Pappa2	APN	1	158936933	missense	probably damaging	1.00
IGL02572:Pappa2	APN	1	158851216	missense	probably benign
IGL02659:Pappa2	APN	1	158936794	missense	probably damaging	0.97
IGL02887:Pappa2	APN	1	158782259	missense	probably damaging	1.00
IGL02981:Pappa2	APN	1	158851144	missense	probably benign	0.00
IGL03128:Pappa2	APN	1	158936484	missense	probably benign	0.16
IGL03142:Pappa2	APN	1	158854931	missense	probably damaging	1.00
IGL03270:Pappa2	APN	1	158765067	missense	possibly damaging	0.78
Gulliver	UTSW	1	158857136	missense	probably null	1.00
Lilliputian	UTSW	1	158716990	missense	probably damaging	1.00
Lilliputian2	UTSW	1	158834918	nonsense	probably null
lilliputian3	UTSW	1	158782403	splice site	probably null
Pitzel	UTSW	1	158956645	missense	probably damaging	1.00
R0106:Pappa2	UTSW	1	158714977	missense	probably damaging	1.00
R0106:Pappa2	UTSW	1	158714977	missense	probably damaging	1.00
R0172:Pappa2	UTSW	1	158854849	critical splice donor site	probably null
R0194:Pappa2	UTSW	1	158765101	splice site	probably benign
R0418:Pappa2	UTSW	1	158716990	missense	probably damaging	1.00
R0421:Pappa2	UTSW	1	158848080	missense	probably damaging	1.00
R0441:Pappa2	UTSW	1	158763058	unclassified	probably benign
R0602:Pappa2	UTSW	1	158763055	unclassified	probably benign
R0630:Pappa2	UTSW	1	158832773	missense	probably benign
R0760:Pappa2	UTSW	1	158716961	critical splice donor site	probably null
R1146:Pappa2	UTSW	1	158854982	missense	probably damaging	1.00
R1146:Pappa2	UTSW	1	158854982	missense	probably damaging	1.00
R1243:Pappa2	UTSW	1	158845100	missense	probably damaging	1.00
R1413:Pappa2	UTSW	1	158936554	missense	probably benign	0.00
R1502:Pappa2	UTSW	1	158957288	missense	probably damaging	1.00
R1599:Pappa2	UTSW	1	158857172	missense	probably damaging	1.00
R1689:Pappa2	UTSW	1	158957398	missense	probably damaging	1.00
R1750:Pappa2	UTSW	1	158763150	nonsense	probably null
R1772:Pappa2	UTSW	1	158814368	missense	possibly damaging	0.92
R1832:Pappa2	UTSW	1	158857316	missense	probably damaging	1.00
R1905:Pappa2	UTSW	1	158803503	splice site	probably null
R1914:Pappa2	UTSW	1	158750563	missense	probably damaging	0.97
R2013:Pappa2	UTSW	1	158834928	missense	probably damaging	1.00
R2037:Pappa2	UTSW	1	158956644	nonsense	probably null
R2118:Pappa2	UTSW	1	158857266	missense	probably damaging	1.00
R2268:Pappa2	UTSW	1	158857271	missense	probably damaging	1.00
R2347:Pappa2	UTSW	1	158765043	missense	probably damaging	1.00
R3024:Pappa2	UTSW	1	158936225	missense	probably benign	0.00
R3706:Pappa2	UTSW	1	158834918	nonsense	probably null
R3707:Pappa2	UTSW	1	158834918	nonsense	probably null
R3708:Pappa2	UTSW	1	158834918	nonsense	probably null
R4600:Pappa2	UTSW	1	158814445	missense	probably damaging	1.00
R4737:Pappa2	UTSW	1	158957012	missense	probably benign
R4738:Pappa2	UTSW	1	158957012	missense	probably benign
R4739:Pappa2	UTSW	1	158957002	missense	probably damaging	0.99
R4739:Pappa2	UTSW	1	158957012	missense	probably benign
R4788:Pappa2	UTSW	1	158783917	missense	possibly damaging	0.86
R4798:Pappa2	UTSW	1	158857379	missense	probably damaging	0.99
R4952:Pappa2	UTSW	1	158857136	missense	probably null	1.00
R5121:Pappa2	UTSW	1	158838627	missense	probably benign	0.01
R5144:Pappa2	UTSW	1	158957133	missense	probably benign	0.03
R5159:Pappa2	UTSW	1	158761619	missense	probably damaging	1.00
R5278:Pappa2	UTSW	1	158782403	splice site	probably null
R5428:Pappa2	UTSW	1	158814785	missense	possibly damaging	0.53
R5452:Pappa2	UTSW	1	158838602	missense	probably benign	0.00
R5477:Pappa2	UTSW	1	158956738	missense	probably benign	0.00
R5504:Pappa2	UTSW	1	158848045	missense	probably benign	0.00
R5852:Pappa2	UTSW	1	158717014	missense	probably damaging	1.00
R6003:Pappa2	UTSW	1	158936250	missense	probably benign	0.23
R6129:Pappa2	UTSW	1	158714997	nonsense	probably null
R6137:Pappa2	UTSW	1	158871543	missense	probably damaging	1.00
R6374:Pappa2	UTSW	1	158956645	missense	probably damaging	1.00
R6472:Pappa2	UTSW	1	158834799	missense	probably damaging	1.00
R6804:Pappa2	UTSW	1	158936868	missense	probably benign	0.24
R7020:Pappa2	UTSW	1	158848009	missense	probably damaging	0.98
R7051:Pappa2	UTSW	1	158957183	missense	unknown
R7082:Pappa2	UTSW	1	158763119	missense	possibly damaging	0.65
R7111:Pappa2	UTSW	1	158956526	missense	probably benign	0.38
R7213:Pappa2	UTSW	1	158936886	missense	possibly damaging	0.93
R7575:Pappa2	UTSW	1	158814530	missense	probably damaging	1.00
R7587:Pappa2	UTSW	1	158851131	missense	probably damaging	1.00
R7826:Pappa2	UTSW	1	158936440	nonsense	probably null
R7957:Pappa2	UTSW	1	158761561	nonsense	probably null
R8007:Pappa2	UTSW	1	158782304	missense	probably damaging	0.99
R8050:Pappa2	UTSW	1	158848400	missense	probably damaging	1.00
R8063:Pappa2	UTSW	1	158936556	missense	possibly damaging	0.79
R8068:Pappa2	UTSW	1	158935985	missense	possibly damaging	0.87
R8128:Pappa2	UTSW	1	158936664	missense	possibly damaging	0.75
R8264:Pappa2	UTSW	1	158854973	missense	probably damaging	1.00
R8317:Pappa2	UTSW	1	158764960	missense	probably damaging	1.00
R8499:Pappa2	UTSW	1	158936522	missense	probably damaging	1.00
X0058:Pappa2	UTSW	1	158814397	missense	probably null
X0061:Pappa2	UTSW	1	158936618	missense	possibly damaging	0.87
Z1176:Pappa2	UTSW	1	158814814	missense	probably damaging	1.00
Z1176:Pappa2	UTSW	1	158814816	missense	probably damaging	1.00
Z1176:Pappa2	UTSW	1	158956933	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACATGAATCTTCCTGGCTCC -3'
(R):5'- CAATCTTTCCATTACAGGTGGTG -3'

Sequencing Primer
(F):5'- GACATGAATCTTCCTGGCTCCATTAG -3'
(R):5'- CCATTACAGGTGGTGTTGTCCTC -3'

Posted On

2014-10-16