Incidental Mutation 'R2269:Foxn4'
ID242305
Institutional Source Beutler Lab
Gene Symbol Foxn4
Ensembl Gene ENSMUSG00000042002
Gene Nameforkhead box N4
Synonyms
MMRRC Submission 040269-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2269 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location114254164-114273807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114255601 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 486 (T486A)
Ref Sequence ENSEMBL: ENSMUSP00000047951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000044790] [ENSMUST00000102582] [ENSMUST00000129530] [ENSMUST00000144050]
Predicted Effect probably benign
Transcript: ENSMUST00000031583
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044790
AA Change: T486A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047951
Gene: ENSMUSG00000042002
AA Change: T486A

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
FH 195 287 2.15e-46 SMART
low complexity region 386 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102582
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Predicted Effect probably benign
Transcript: ENSMUST00000144050
Meta Mutation Damage Score 0.1526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the winged-helix/forkhead family of transcription factors, such as FOXN4, are characterized by a 110-amino acid DNA-binding domain that can fold into a variant of the helix-turn-helix motif consisting of 3 alpha helices flanked by 2 large loops or wings. These transcription factors are involved in a variety of biologic processes as key regulators in development and metabolism (Li et al., 2004 [PubMed 15363391]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and abnormal retina morphology with a total loss of horizontal cells and decreased amacrine cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Foxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02990:Foxn4 APN 5 114272989 missense probably damaging 0.98
R0001:Foxn4 UTSW 5 114260870 missense probably damaging 1.00
R0194:Foxn4 UTSW 5 114259748 critical splice donor site probably null
R0555:Foxn4 UTSW 5 114263114 missense probably damaging 1.00
R0617:Foxn4 UTSW 5 114261068 splice site probably benign
R1662:Foxn4 UTSW 5 114256894 missense probably benign
R1785:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R1786:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R2266:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2267:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2268:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2397:Foxn4 UTSW 5 114255495 missense probably damaging 1.00
R3121:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R3122:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R4579:Foxn4 UTSW 5 114256825 missense possibly damaging 0.65
R4623:Foxn4 UTSW 5 114260930 missense possibly damaging 0.64
R4749:Foxn4 UTSW 5 114255567 missense probably damaging 1.00
R5083:Foxn4 UTSW 5 114256927 missense probably damaging 1.00
R5100:Foxn4 UTSW 5 114256759 missense possibly damaging 0.87
R5661:Foxn4 UTSW 5 114272992 missense probably benign
R7015:Foxn4 UTSW 5 114256855 missense possibly damaging 0.95
R7292:Foxn4 UTSW 5 114258655 nonsense probably null
R7342:Foxn4 UTSW 5 114258699 missense probably damaging 1.00
R7627:Foxn4 UTSW 5 114260434 missense possibly damaging 0.87
R7695:Foxn4 UTSW 5 114256587 missense probably damaging 1.00
R7970:Foxn4 UTSW 5 114263007 critical splice donor site probably null
R8037:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
R8038:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACAAGCTGTCATTTCCC -3'
(R):5'- TTGAACTCAGGGCTGATTGG -3'

Sequencing Primer
(F):5'- TCCCCCGTCAGCAATTGG -3'
(R):5'- GGCTGATTGGCCCTAAGC -3'
Posted On2014-10-16