Incidental Mutation 'R2269:Banp'
ID242322
Institutional Source Beutler Lab
Gene Symbol Banp
Ensembl Gene ENSMUSG00000025316
Gene NameBTG3 associated nuclear protein
SynonymsSMAR1
MMRRC Submission 040269-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R2269 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location121949750-122029258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121975923 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 70 (T70A)
Ref Sequence ENSEMBL: ENSMUSP00000133342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026354] [ENSMUST00000093078] [ENSMUST00000127664] [ENSMUST00000170857] [ENSMUST00000172511] [ENSMUST00000172628] [ENSMUST00000172681] [ENSMUST00000173254] [ENSMUST00000174753] [ENSMUST00000174445]
Predicted Effect probably benign
Transcript: ENSMUST00000026354
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026354
Gene: ENSMUSG00000025316
AA Change: T32A

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
BEN 218 291 6.7e-21 SMART
low complexity region 301 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093078
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090766
Gene: ENSMUSG00000025316
AA Change: T32A

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
BEN 218 291 6.7e-21 SMART
low complexity region 301 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170857
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132095
Gene: ENSMUSG00000025316
AA Change: T32A

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172511
AA Change: T32A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133365
Gene: ENSMUSG00000025316
AA Change: T32A

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172513
Predicted Effect probably benign
Transcript: ENSMUST00000172628
AA Change: T70A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133342
Gene: ENSMUSG00000025316
AA Change: T70A

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
coiled coil region 99 136 N/A INTRINSIC
low complexity region 182 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172681
AA Change: T32A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000173254
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133783
Gene: ENSMUSG00000025316
AA Change: T32A

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173753
Predicted Effect probably benign
Transcript: ENSMUST00000174753
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134058
Gene: ENSMUSG00000025316
AA Change: T32A

DomainStartEndE-ValueType
coiled coil region 52 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174445
AA Change: T32A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174536
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Banp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Banp APN 8 122007091 missense probably benign 0.02
IGL02981:Banp APN 8 121978564 missense possibly damaging 0.89
PIT4418001:Banp UTSW 8 122005626 missense probably damaging 1.00
R0926:Banp UTSW 8 122020555 missense probably benign
R1209:Banp UTSW 8 121975917 missense possibly damaging 0.79
R1635:Banp UTSW 8 122001011 missense probably damaging 1.00
R2229:Banp UTSW 8 121978685 missense probably damaging 0.99
R3052:Banp UTSW 8 122005687 splice site probably null
R5155:Banp UTSW 8 122001020 missense probably damaging 1.00
R5554:Banp UTSW 8 121991595 missense probably damaging 1.00
R6479:Banp UTSW 8 121991437 splice site probably null
R7376:Banp UTSW 8 121974497 missense probably damaging 0.99
R7468:Banp UTSW 8 121949849 critical splice donor site probably null
R7646:Banp UTSW 8 122024036 missense possibly damaging 0.94
R7702:Banp UTSW 8 121978587 nonsense probably null
R7832:Banp UTSW 8 122020552 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTGGCTGAGGATTTTAAC -3'
(R):5'- CGAGTAATAAGGCTGGGACC -3'

Sequencing Primer
(F):5'- GGATTTTAACAAAGAAATGGCTGTGC -3'
(R):5'- CTCCTTAGAATCCCAGAAGGTGTG -3'
Posted On2014-10-16