Incidental Mutation 'R2269:Dock3'
ID242327
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission 040269-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R2269 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106941326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1190 (V1190F)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: V1190F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: V1190F

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165075
SMART Domains Protein: ENSMUSP00000130873
Gene: ENSMUSG00000039716

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168759
AA Change: V56F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131410
Gene: ENSMUSG00000039716
AA Change: V56F

DomainStartEndE-ValueType
Pfam:DHR-2 1 241 4e-48 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Squeeze UTSW 9 106930043 missense probably damaging 1.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
R7357:Dock3 UTSW 9 107005369 missense probably benign 0.34
R7423:Dock3 UTSW 9 106967171 missense probably damaging 0.98
R7426:Dock3 UTSW 9 106895583 missense probably benign
R7439:Dock3 UTSW 9 107023732 missense probably damaging 1.00
R7452:Dock3 UTSW 9 106989465 missense probably damaging 1.00
R7470:Dock3 UTSW 9 107005445 missense probably damaging 1.00
R7879:Dock3 UTSW 9 106908501 missense probably benign 0.05
R8047:Dock3 UTSW 9 106993009 missense possibly damaging 0.93
R8308:Dock3 UTSW 9 106913172 missense probably benign 0.00
R8837:Dock3 UTSW 9 106897340 missense probably benign
R8862:Dock3 UTSW 9 106978728 missense probably damaging 1.00
R8952:Dock3 UTSW 9 106973759 missense probably benign 0.03
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTTCCTTTGTTGAAACAGTGA -3'
(R):5'- CCAGGTAAGACTACAGTGTGGC -3'

Sequencing Primer
(F):5'- GCATTGACTATCCTGGACCTAGAG -3'
(R):5'- AGACTACAGTGTGGCAAGTCTTC -3'
Posted On2014-10-16