Incidental Mutation 'R2269:Clec16a'
ID242352
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission 040269-MU
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2269 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10644786 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 656 (R656H)
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably damaging
Transcript: ENSMUST00000038145
AA Change: R672H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663
AA Change: R672H

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066345
AA Change: R658H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: R658H

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115823
AA Change: R237H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663
AA Change: R237H

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115824
AA Change: R658H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: R658H

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115827
AA Change: R672H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663
AA Change: R672H

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145866
Predicted Effect probably damaging
Transcript: ENSMUST00000155633
AA Change: R656H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: R656H

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Meta Mutation Damage Score 0.7953 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 splice site probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
R8207:Clec16a UTSW 16 10627448 missense probably benign 0.00
R8207:Clec16a UTSW 16 10694710 missense probably damaging 1.00
R8423:Clec16a UTSW 16 10576663 missense probably benign 0.04
R8447:Clec16a UTSW 16 10741623 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTGAAGTGACCCAGGCTTC -3'
(R):5'- CACAGCAGGTCAAATGACAG -3'

Sequencing Primer
(F):5'- AGGCTTCAACCTGTTGGGGAC -3'
(R):5'- GAGCAAAGCCTGTATCCCCTG -3'
Posted On2014-10-16