Incidental Mutation 'R2269:Gbe1'
ID242354
Institutional Source Beutler Lab
Gene Symbol Gbe1
Ensembl Gene ENSMUSG00000022707
Gene Nameglucan (1,4-alpha-), branching enzyme 1
Synonyms2310045H19Rik, D16Ertd536e, 2810426P10Rik
MMRRC Submission 040269-MU
Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2269 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location70313949-70569716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70436952 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 239 (A239V)
Ref Sequence ENSEMBL: ENSMUSP00000127642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464] [ENSMUST00000171132]
Predicted Effect probably damaging
Transcript: ENSMUST00000023393
AA Change: A239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707
AA Change: A239V

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163832
AA Change: A239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707
AA Change: A239V

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 6e-19 PFAM
Pfam:Alpha-amylase 220 337 5.9e-14 PFAM
Pfam:Alpha-amylase_C 603 698 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164300
Predicted Effect probably damaging
Transcript: ENSMUST00000170464
AA Change: A239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707
AA Change: A239V

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171132
AA Change: A239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127642
Gene: ENSMUSG00000022707
AA Change: A239V

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 1.8e-17 PFAM
Pfam:Alpha-amylase 218 338 2.7e-18 PFAM
Pfam:Alpha-amylase_C 603 650 4.1e-12 PFAM
Meta Mutation Damage Score 0.9096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srd5a2 T C 17: 74,024,490 R171G probably damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Gbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Gbe1 APN 16 70478369 missense probably damaging 1.00
IGL01783:Gbe1 APN 16 70401855 critical splice donor site probably null
IGL02437:Gbe1 APN 16 70434658 splice site probably benign
IGL02635:Gbe1 APN 16 70569014 missense probably damaging 1.00
IGL02836:Gbe1 APN 16 70561095 missense possibly damaging 0.90
IGL03331:Gbe1 APN 16 70433578 missense probably damaging 1.00
IGL03138:Gbe1 UTSW 16 70529063 utr 3 prime probably benign
PIT4515001:Gbe1 UTSW 16 70441116 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0131:Gbe1 UTSW 16 70360852 splice site probably benign
R0178:Gbe1 UTSW 16 70478386 missense probably damaging 1.00
R0374:Gbe1 UTSW 16 70483914 missense probably benign 0.09
R1036:Gbe1 UTSW 16 70528887 missense probably damaging 1.00
R1162:Gbe1 UTSW 16 70381850 intron probably benign
R1759:Gbe1 UTSW 16 70488041 missense probably benign 0.11
R1780:Gbe1 UTSW 16 70495324 nonsense probably null
R1998:Gbe1 UTSW 16 70569041 missense probably damaging 1.00
R2001:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2002:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2353:Gbe1 UTSW 16 70437021 splice site probably null
R2434:Gbe1 UTSW 16 70441212 missense probably damaging 1.00
R4114:Gbe1 UTSW 16 70483827 missense possibly damaging 0.64
R4528:Gbe1 UTSW 16 70478337 missense probably benign
R4736:Gbe1 UTSW 16 70495253 missense probably damaging 1.00
R4859:Gbe1 UTSW 16 70478401 missense probably damaging 1.00
R5884:Gbe1 UTSW 16 70528875 splice site probably null
R6222:Gbe1 UTSW 16 70529012 critical splice donor site probably null
R6527:Gbe1 UTSW 16 70433672 critical splice donor site probably null
R6770:Gbe1 UTSW 16 70314265 missense possibly damaging 0.86
R6770:Gbe1 UTSW 16 70401838 missense probably damaging 1.00
R6941:Gbe1 UTSW 16 70433556 small deletion probably benign
R7193:Gbe1 UTSW 16 70495370 missense probably damaging 1.00
R7232:Gbe1 UTSW 16 70436940 missense possibly damaging 0.91
R7343:Gbe1 UTSW 16 70361015 missense probably benign 0.09
R7810:Gbe1 UTSW 16 70527197 missense possibly damaging 0.92
R7822:Gbe1 UTSW 16 70433612 missense probably damaging 0.98
R7876:Gbe1 UTSW 16 70441171 missense probably benign
R8319:Gbe1 UTSW 16 70488076 missense probably benign 0.05
R8487:Gbe1 UTSW 16 70436988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTTAGGAGGTCAGACAAG -3'
(R):5'- GCATGACAGGAAATCTAGGCC -3'

Sequencing Primer
(F):5'- TGTTAGGAGGTCAGACAAGTAAATTG -3'
(R):5'- TGTACATCTGAAGAAAGTGACCC -3'
Posted On2014-10-16