Incidental Mutation 'R2269:Srd5a2'
ID242362
Institutional Source Beutler Lab
Gene Symbol Srd5a2
Ensembl Gene ENSMUSG00000038541
Gene Namesteroid 5 alpha-reductase 2
Synonyms5ART2
MMRRC Submission 040269-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R2269 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74017706-74047916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74024490 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 171 (R171G)
Ref Sequence ENSEMBL: ENSMUSP00000048862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043458]
Predicted Effect probably damaging
Transcript: ENSMUST00000043458
AA Change: R171G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048862
Gene: ENSMUSG00000038541
AA Change: R171G

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:Steroid_dh 105 254 4.6e-62 PFAM
Meta Mutation Damage Score 0.4563 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant males are fertile, but have small prostates and seminal vesicles, elevated testosterone in reproductive tissue and decreased androgen-dependent gene expression. Mutant females exhibit no detectable abnormality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,431,160 D165G probably benign Het
Abca8a A C 11: 110,026,892 F1574V probably damaging Het
Adh6a A T 3: 138,329,096 I329L probably benign Het
Agap2 T A 10: 127,082,428 probably benign Het
Ager A T 17: 34,599,150 I185F probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Arhgef16 T A 4: 154,285,033 H329L probably damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Banp A G 8: 121,975,923 T70A probably benign Het
Bcl11b T C 12: 107,915,651 T802A possibly damaging Het
Ces2a A T 8: 104,740,190 I65F probably benign Het
Cflar G A 1: 58,741,047 probably null Het
Clec16a G A 16: 10,644,786 R656H probably damaging Het
Cntn1 A G 15: 92,294,982 probably benign Het
Coasy A G 11: 101,085,882 T493A probably benign Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp3a41b A T 5: 145,578,166 V83D probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Decr2 C A 17: 26,083,884 V173L probably benign Het
Defb11 A G 8: 21,905,428 *78Q probably null Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Dusp1 A T 17: 26,507,119 I200N probably damaging Het
Efna1 G A 3: 89,276,339 A60V possibly damaging Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Epb41 T A 4: 131,964,147 N623I probably benign Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Gbe1 C T 16: 70,436,952 A239V probably damaging Het
Gpatch3 C T 4: 133,583,807 A518V possibly damaging Het
Gpc6 A T 14: 117,888,520 probably null Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hnrnpul1 A G 7: 25,750,874 Y138H probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lrrc43 A T 5: 123,503,291 T513S probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mamdc2 A T 19: 23,303,903 probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh5 T C 15: 73,793,148 N258D probably benign Het
Mrpl28 T C 17: 26,126,311 V235A probably benign Het
Mtbp G A 15: 55,569,160 probably null Het
Mtss1l A G 8: 110,728,730 K92E possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr382 A G 11: 73,516,483 S239P probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Pkhd1 C T 1: 20,534,535 probably null Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Pxdn T A 12: 30,005,775 V1220E probably damaging Het
Robo1 T A 16: 72,978,772 F728L probably benign Het
Rtel1 G T 2: 181,336,003 Q292H probably benign Het
Sh3bp4 G A 1: 89,145,592 V721I possibly damaging Het
Slc2a10 T A 2: 165,514,781 C120* probably null Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbx1 T C 16: 18,581,994 probably null Het
Tmem233 G C 5: 116,051,458 probably benign Het
Tmem252 T C 19: 24,674,091 I8T probably benign Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r107 T C 17: 20,375,555 I790T possibly damaging Het
Vmn2r77 T C 7: 86,811,689 V741A probably benign Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Ylpm1 T A 12: 85,015,050 V575E unknown Het
Zbp1 T A 2: 173,218,823 probably benign Het
Zfp280d C A 9: 72,301,770 probably benign Het
Zkscan5 A G 5: 145,205,467 Y58C probably damaging Het
Other mutations in Srd5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0924:Srd5a2 UTSW 17 74024521 missense probably damaging 1.00
R1661:Srd5a2 UTSW 17 74021481 missense probably damaging 1.00
R1665:Srd5a2 UTSW 17 74021481 missense probably damaging 1.00
R3608:Srd5a2 UTSW 17 74027031 missense probably benign 0.05
R4825:Srd5a2 UTSW 17 74047805 missense probably benign
R5698:Srd5a2 UTSW 17 74027019 missense possibly damaging 0.67
R6378:Srd5a2 UTSW 17 74021383 critical splice donor site probably null
R7015:Srd5a2 UTSW 17 74027119 missense probably benign 0.12
R7082:Srd5a2 UTSW 17 74021520 missense probably damaging 1.00
R7677:Srd5a2 UTSW 17 74047754 missense probably damaging 0.99
R7813:Srd5a2 UTSW 17 74024546 missense probably benign
R8804:Srd5a2 UTSW 17 74047634 missense possibly damaging 0.63
Z1177:Srd5a2 UTSW 17 74021496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTAACAAGGCTAACCCTGA -3'
(R):5'- TGAGAATCCGGCCCCAAAAC -3'

Sequencing Primer
(F):5'- ACCATGCCTGGAGTTAACTG -3'
(R):5'- GAGAATCCGGCCCCAAAACTAAAC -3'
Posted On2014-10-16