Incidental Mutation 'R2270:Slc1a2'
ID242373
Institutional Source Beutler Lab
Gene Symbol Slc1a2
Ensembl Gene ENSMUSG00000005089
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms2900019G14Rik, 1700091C19Rik, MGLT1, GLT1, Eaat2, GLT-1
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R2270 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location102658659-102790784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102735994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 14 (L14R)
Ref Sequence ENSEMBL: ENSMUSP00000115129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005220] [ENSMUST00000080210] [ENSMUST00000111212] [ENSMUST00000111213] [ENSMUST00000123759]
Predicted Effect probably damaging
Transcript: ENSMUST00000005220
AA Change: L20R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005220
Gene: ENSMUSG00000005089
AA Change: L20R

DomainStartEndE-ValueType
Pfam:SDF 43 492 8.9e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080210
AA Change: L23R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079100
Gene: ENSMUSG00000005089
AA Change: L23R

DomainStartEndE-ValueType
Pfam:SDF 46 495 3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111212
AA Change: L20R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106843
Gene: ENSMUSG00000005089
AA Change: L20R

DomainStartEndE-ValueType
Pfam:SDF 43 492 9.5e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111213
AA Change: L23R

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106844
Gene: ENSMUSG00000005089
AA Change: L23R

DomainStartEndE-ValueType
Pfam:SDF 46 495 2e-134 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123759
AA Change: L14R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115129
Gene: ENSMUSG00000005089
AA Change: L14R

DomainStartEndE-ValueType
Pfam:SDF 37 157 4.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145921
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display spontaneous seizures often leading to death as well as a succeptibility to neuronal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr741 G T 14: 50,486,037 C193F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rere T C 4: 150,477,380 S248P unknown Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Slc1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc1a2 APN 2 102777576 missense possibly damaging 0.55
IGL00588:Slc1a2 APN 2 102756001 missense probably benign
IGL00931:Slc1a2 APN 2 102756112 missense probably damaging 1.00
IGL00942:Slc1a2 APN 2 102739814 missense probably damaging 1.00
IGL02100:Slc1a2 APN 2 102756089 missense probably damaging 1.00
IGL02173:Slc1a2 APN 2 102743861 missense probably benign 0.05
IGL02184:Slc1a2 APN 2 102748544 missense probably damaging 1.00
IGL02480:Slc1a2 APN 2 102736066 missense probably damaging 1.00
IGL02643:Slc1a2 APN 2 102739880 missense probably benign 0.30
IGL03332:Slc1a2 APN 2 102748534 missense possibly damaging 0.96
R0335:Slc1a2 UTSW 2 102743863 missense probably benign
R0544:Slc1a2 UTSW 2 102756072 missense probably damaging 0.99
R0570:Slc1a2 UTSW 2 102756007 missense probably damaging 1.00
R1472:Slc1a2 UTSW 2 102737909 missense probably damaging 1.00
R1536:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R1856:Slc1a2 UTSW 2 102777567 missense probably damaging 0.97
R1936:Slc1a2 UTSW 2 102777605 missense probably benign 0.04
R1965:Slc1a2 UTSW 2 102739900 missense probably damaging 1.00
R2365:Slc1a2 UTSW 2 102748453 intron probably null
R2567:Slc1a2 UTSW 2 102767010 missense probably damaging 1.00
R2878:Slc1a2 UTSW 2 102761167 missense probably damaging 1.00
R3080:Slc1a2 UTSW 2 102748556 missense probably damaging 1.00
R4716:Slc1a2 UTSW 2 102748538 missense probably damaging 0.96
R4744:Slc1a2 UTSW 2 102737869 missense probably benign 0.41
R5197:Slc1a2 UTSW 2 102756115 missense probably benign 0.02
R5835:Slc1a2 UTSW 2 102777450 missense probably damaging 1.00
R7077:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R7155:Slc1a2 UTSW 2 102766995 missense probably damaging 1.00
R7179:Slc1a2 UTSW 2 102755945 missense probably damaging 1.00
R7455:Slc1a2 UTSW 2 102735954 missense probably benign 0.16
R7492:Slc1a2 UTSW 2 102739930 nonsense probably null
R7818:Slc1a2 UTSW 2 102743956 missense probably benign 0.06
R7868:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
R7951:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
X0065:Slc1a2 UTSW 2 102737831 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCCCTATGGTCAACTGAAATG -3'
(R):5'- CATTGAGGCAGTCACCTGTC -3'

Sequencing Primer
(F):5'- GAAATGCAGTGTGACCTCAGCATTC -3'
(R):5'- TCTTCAGGAAGTCCACTCTGAGAG -3'
Posted On2014-10-16