Incidental Mutation 'R2270:Cdh22'
ID242376
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2270 (G1)
Quality Score128
Status Not validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 165143847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000065438] [ENSMUST00000065438] [ENSMUST00000138643] [ENSMUST00000138643]
Predicted Effect probably null
Transcript: ENSMUST00000065438
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065438
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065438
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138643
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr741 G T 14: 50,486,037 C193F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rere T C 4: 150,477,380 S248P unknown Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slc1a2 T G 2: 102,735,994 L14R probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7595:Cdh22 UTSW 2 165112463 missense probably benign 0.00
R7601:Cdh22 UTSW 2 165112546 missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATGATGGCTTCCTGAGTGTC -3'
(R):5'- TCTGATTGCATGATCCTGCC -3'

Sequencing Primer
(F):5'- TCCTGAGTGTCGCTGTCCG -3'
(R):5'- ATGATCCTGCCCTTCAGAGG -3'
Posted On2014-10-16