Incidental Mutation 'R2270:Arid3c'
ID 242378
Institutional Source Beutler Lab
Gene Symbol Arid3c
Ensembl Gene ENSMUSG00000066224
Gene Name AT rich interactive domain 3C (BRIGHT-like)
Synonyms OTTMUSG00000006683
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock # R2270 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 41723836-41731142 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41724744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 364 (I364F)
Ref Sequence ENSEMBL: ENSMUSP00000127678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000084698] [ENSMUST00000108041] [ENSMUST00000150809] [ENSMUST00000171251] [ENSMUST00000171641]
AlphaFold A6PWV5
Predicted Effect probably benign
Transcript: ENSMUST00000030158
SMART Domains Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 6 170 2.8e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084698
AA Change: I364F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081748
Gene: ENSMUSG00000066224
AA Change: I364F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147120
Predicted Effect probably benign
Transcript: ENSMUST00000150809
SMART Domains Protein: ENSMUSP00000116411
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 357 379 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171251
AA Change: I364F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127678
Gene: ENSMUSG00000066224
AA Change: I364F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171641
SMART Domains Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 1 149 1.4e-63 PFAM
Meta Mutation Damage Score 0.4420 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the ARID (AT-rich interaction domain) family of proteins. The ARID domain is a helix-turn-helix motif-based DNA-binding domain. ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr741 G T 14: 50,486,037 C193F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rere T C 4: 150,477,380 S248P unknown Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slc1a2 T G 2: 102,735,994 L14R probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Arid3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Arid3c APN 4 41730021 missense possibly damaging 0.72
R0445:Arid3c UTSW 4 41725172 missense probably benign 0.00
R0675:Arid3c UTSW 4 41725958 missense probably damaging 1.00
R1617:Arid3c UTSW 4 41725103 missense probably damaging 1.00
R1711:Arid3c UTSW 4 41725947 missense probably damaging 0.99
R1929:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2271:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2272:Arid3c UTSW 4 41724744 missense probably damaging 1.00
R2867:Arid3c UTSW 4 41725958 missense probably damaging 1.00
R2867:Arid3c UTSW 4 41725958 missense probably damaging 1.00
R4818:Arid3c UTSW 4 41730072 missense possibly damaging 0.72
R5622:Arid3c UTSW 4 41729959 missense probably benign 0.02
R6289:Arid3c UTSW 4 41724285 unclassified probably benign
R6995:Arid3c UTSW 4 41725087 missense probably damaging 1.00
R7339:Arid3c UTSW 4 41729883 critical splice donor site probably null
R8244:Arid3c UTSW 4 41729997 missense possibly damaging 0.61
R9009:Arid3c UTSW 4 41729925 missense probably benign 0.00
R9324:Arid3c UTSW 4 41730138 missense possibly damaging 0.86
Z1177:Arid3c UTSW 4 41730177 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCTTGTAGACAAACTCTTGAATCC -3'
(R):5'- CACATGCTGAATGCTGGAGG -3'

Sequencing Primer
(F):5'- CCTGAACGTCATGCTCAT -3'
(R):5'- TGGTACAGGCAGGTCCCTTG -3'
Posted On 2014-10-16