Incidental Mutation 'R0167:Hist1h1t'
ID24238
Institutional Source Beutler Lab
Gene Symbol Hist1h1t
Ensembl Gene ENSMUSG00000036211
Gene Namehistone cluster 1, H1t
SynonymsH1ft
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0167 (G1)
Quality Score193
Status Validated
Chromosome13
Chromosomal Location23695814-23696725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23695903 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000037304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018246] [ENSMUST00000041052] [ENSMUST00000102967]
Predicted Effect probably benign
Transcript: ENSMUST00000018246
SMART Domains Protein: ENSMUSP00000018246
Gene: ENSMUSG00000018102

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041052
AA Change: V13A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037304
Gene: ENSMUSG00000036211
AA Change: V13A

DomainStartEndE-ValueType
H15 37 102 5.15e-21 SMART
low complexity region 111 135 N/A INTRINSIC
low complexity region 142 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102967
SMART Domains Protein: ENSMUSP00000100032
Gene: ENSMUSG00000060678

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice develop normally and exhibit normal testicular morphology, spermatogenesis and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Hist1h1t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Hist1h1t APN 13 23696049 missense probably damaging 0.98
FR4304:Hist1h1t UTSW 13 23695920 unclassified probably benign
FR4342:Hist1h1t UTSW 13 23695913 unclassified probably benign
FR4548:Hist1h1t UTSW 13 23695920 unclassified probably benign
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0564:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0726:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0827:Hist1h1t UTSW 13 23696221 missense probably benign 0.01
R0972:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1128:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1129:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1130:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R5652:Hist1h1t UTSW 13 23696236 missense probably benign 0.01
R5827:Hist1h1t UTSW 13 23696202 missense possibly damaging 0.91
R6538:Hist1h1t UTSW 13 23695921 missense probably benign 0.06
R7729:Hist1h1t UTSW 13 23696472 missense possibly damaging 0.93
R7774:Hist1h1t UTSW 13 23696200 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCACCTGGTGTCATAACCTGAGC -3'
(R):5'- AGAAGCAGATTTCTTGCCCTTGCC -3'

Sequencing Primer
(F):5'- GGTGTCATAACCTGAGCAATTCTG -3'
(R):5'- CTTACTGAGCTTGAAGGAGCC -3'
Posted On2013-04-16