Mutagenetix > Incidental Mutations

Incidental Mutation 'R2270:Rere'

242381

Institutional Source

Beutler Lab

Gene Symbol

Rere

Ensembl Gene

ENSMUSG00000039852

Gene Name

arginine glutamic acid dipeptide (RE) repeats

Synonyms

1110033A15Rik, eyes3, Atr2, eye, atrophin-2

MMRRC Submission

040270-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2270 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150281646-150621966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 150477380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 248 (S248P)

Ref Sequence

ENSEMBL: ENSMUSP00000101307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105682]

AlphaFold

Q80TZ9

Predicted Effect

unknown
Transcript: ENSMUST00000105682
AA Change: S248P

SMART Domains

Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: S248P

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	52	65	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
BAH	103	283	3.52e-13	SMART
ELM2	286	338	1.67e-13	SMART
SANT	392	441	1.8e-6	SMART
low complexity region	444	461	N/A	INTRINSIC
ZnF_GATA	501	552	1.94e-15	SMART
Pfam:Atrophin-1	568	1557	N/A	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	G	A	19: 57,077,431	R54W	possibly damaging	Het
Adam22	T	C	5: 8,121,108	E614G	probably damaging	Het
Ap4e1	T	C	2: 127,047,163		probably null	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atp11b	A	G	3: 35,810,134		probably null	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Chat	T	C	14: 32,454,581	R79G	probably damaging	Het
Chek1	A	G	9: 36,719,686	L144P	probably damaging	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Crip2	A	C	12: 113,144,866	K62N	probably damaging	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnm3	A	T	1: 162,477,789	L12Q	probably damaging	Het
Eftud2	T	C	11: 102,864,781	N200S	probably damaging	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fgfbp1	T	A	5: 43,979,330	M207L	probably benign	Het
Fry	A	G	5: 150,400,924	I1151V	probably null	Het
Garem2	T	G	5: 30,116,974	L777R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gpr143	T	A	X: 152,790,570	V181E	probably damaging	Het
Gtf2f1	T	C	17: 57,003,462	I498V	probably null	Het
Ipo4	A	G	14: 55,634,100	L168P	probably damaging	Het
Ism1	T	A	2: 139,757,373	I415N	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mre11a	A	G	9: 14,815,174	E411G	probably benign	Het
Mybpc1	C	A	10: 88,551,407	V106F	probably benign	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
N4bp3	A	T	11: 51,644,305	N352K	probably benign	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Ncor2	A	G	5: 125,037,955	V515A	probably benign	Het
Ndufv1	C	A	19: 4,008,347	R359L	probably benign	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Olfm4	C	A	14: 80,011,875	T144K	probably damaging	Het
Olfr741	G	T	14: 50,486,037	C193F	probably damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Phf12	G	T	11: 77,984,175	A76S	possibly damaging	Het
Plb1	G	T	5: 32,293,242	D376Y	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prkg1	A	G	19: 30,578,631	V610A	probably benign	Het
Prrc2a	T	C	17: 35,149,536	T2104A	possibly damaging	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Ranbp2	T	C	10: 58,455,927	V252A	probably benign	Het
Rcn3	A	G	7: 45,088,651	S98P	probably damaging	Het
Rnaseh2a	T	C	8: 84,965,419	E75G	probably benign	Het
Slc15a1	A	T	14: 121,479,994	M292K	probably damaging	Het
Slc1a2	T	G	2: 102,735,994	L14R	probably damaging	Het
Slfn2	C	T	11: 83,069,935	R247C	probably damaging	Het
Ttn	T	C	2: 76,948,364	I1218M	probably damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Yme1l1	T	C	2: 23,175,220	I247T	possibly damaging	Het
Zc3h13	T	C	14: 75,332,147	M1478T	probably benign	Het
Zfp444	T	C	7: 6,189,555	C191R	probably damaging	Het
Zfp729b	A	T	13: 67,592,233	C648S	probably damaging	Het
Znhit2	A	G	19: 6,061,231	E2G	probably damaging	Het
Zpbp	A	T	11: 11,418,272	M133K	probably benign	Het

Other mutations in Rere

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Rere	APN	4	150619463	missense	probably damaging	1.00
IGL01465:Rere	APN	4	150509994	missense	unknown
IGL01523:Rere	APN	4	150615555	missense	possibly damaging	0.93
IGL01688:Rere	APN	4	150618436	missense	probably damaging	1.00
IGL02057:Rere	APN	4	150614832	unclassified	probably benign
IGL02621:Rere	APN	4	150613812	unclassified	probably benign
IGL02672:Rere	APN	4	150510026	missense	unknown
R0116:Rere	UTSW	4	150616976	missense	probably benign	0.18
R0119:Rere	UTSW	4	150615322	unclassified	probably benign
R0344:Rere	UTSW	4	150610981	unclassified	probably benign
R0504:Rere	UTSW	4	150615322	unclassified	probably benign
R0630:Rere	UTSW	4	150619088	missense	probably damaging	1.00
R0961:Rere	UTSW	4	150615372	unclassified	probably benign
R1164:Rere	UTSW	4	150534884	missense	unknown
R1424:Rere	UTSW	4	150617038	missense	probably damaging	1.00
R1542:Rere	UTSW	4	150615942	missense	probably damaging	1.00
R1652:Rere	UTSW	4	150612065	unclassified	probably benign
R1953:Rere	UTSW	4	150616837	missense	probably damaging	1.00
R1959:Rere	UTSW	4	150468790	missense	probably benign	0.23
R1966:Rere	UTSW	4	150616873	missense	probably damaging	1.00
R1975:Rere	UTSW	4	150615733	missense	probably damaging	0.99
R2070:Rere	UTSW	4	150614590	unclassified	probably benign
R2115:Rere	UTSW	4	150612561	unclassified	probably benign
R2144:Rere	UTSW	4	150616931	missense	probably damaging	0.99
R2969:Rere	UTSW	4	150570216	missense	unknown
R3699:Rere	UTSW	4	150477362	critical splice acceptor site	probably null
R3723:Rere	UTSW	4	150468795	missense	probably damaging	1.00
R3826:Rere	UTSW	4	150470328	missense	probably benign	0.42
R4234:Rere	UTSW	4	150617405	missense	probably damaging	1.00
R4512:Rere	UTSW	4	150477452	missense	unknown
R4798:Rere	UTSW	4	150615167	unclassified	probably benign
R4883:Rere	UTSW	4	150616053	missense	probably damaging	0.98
R4914:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4916:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4917:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4918:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4966:Rere	UTSW	4	150613816	unclassified	probably benign
R5172:Rere	UTSW	4	150570269	missense	unknown
R5643:Rere	UTSW	4	150617243	missense	probably damaging	1.00
R6058:Rere	UTSW	4	150468798	missense	probably damaging	1.00
R7112:Rere	UTSW	4	150406604	missense	probably benign
R7173:Rere	UTSW	4	150468738	missense	probably damaging	1.00
R7190:Rere	UTSW	4	150610953	missense	unknown
R7699:Rere	UTSW	4	150617098	missense
R7990:Rere	UTSW	4	150614870	missense	unknown
R8070:Rere	UTSW	4	150617375	missense	probably damaging	1.00
R8101:Rere	UTSW	4	150617339	missense	probably damaging	1.00
R8103:Rere	UTSW	4	150617339	missense	probably damaging	1.00
R8215:Rere	UTSW	4	150616967	missense	possibly damaging	0.95
R8254:Rere	UTSW	4	150612672	missense	unknown
R8348:Rere	UTSW	4	150619196	missense	probably damaging	1.00
R8448:Rere	UTSW	4	150619196	missense	probably damaging	1.00
R8725:Rere	UTSW	4	150617335	nonsense	probably null
R8790:Rere	UTSW	4	150508875	missense	unknown
R8921:Rere	UTSW	4	150612014	missense	unknown
R8937:Rere	UTSW	4	150614874	unclassified	probably benign
R9345:Rere	UTSW	4	150470313	missense	probably damaging	0.99
R9377:Rere	UTSW	4	150508885	missense	unknown
Z1176:Rere	UTSW	4	150468783	missense	probably damaging	1.00
Z1177:Rere	UTSW	4	150615811	missense

Predicted Primers

PCR Primer
(F):5'- CTAGAGATGTTGCTATTCTCCTGTG -3'
(R):5'- CTGAGTCACTGCTTGGCATC -3'

Sequencing Primer
(F):5'- CTCCTGTGATACTTTATGGGGCTTAC -3'
(R):5'- CTGCTTGGCATCTAACTTAAGCACAG -3'

Posted On

2014-10-16