Incidental Mutation 'R2270:Rere'
ID 242381
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Name arginine glutamic acid dipeptide (RE) repeats
Synonyms 1110033A15Rik, eyes3, Atr2, eye, atrophin-2
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2270 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 150281646-150621966 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150477380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 248 (S248P)
Ref Sequence ENSEMBL: ENSMUSP00000101307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105682]
AlphaFold Q80TZ9
Predicted Effect unknown
Transcript: ENSMUST00000105682
AA Change: S248P
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: S248P

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr741 G T 14: 50,486,037 C193F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slc1a2 T G 2: 102,735,994 L14R probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150619463 missense probably damaging 1.00
IGL01465:Rere APN 4 150509994 missense unknown
IGL01523:Rere APN 4 150615555 missense possibly damaging 0.93
IGL01688:Rere APN 4 150618436 missense probably damaging 1.00
IGL02057:Rere APN 4 150614832 unclassified probably benign
IGL02621:Rere APN 4 150613812 unclassified probably benign
IGL02672:Rere APN 4 150510026 missense unknown
R0116:Rere UTSW 4 150616976 missense probably benign 0.18
R0119:Rere UTSW 4 150615322 unclassified probably benign
R0344:Rere UTSW 4 150610981 unclassified probably benign
R0504:Rere UTSW 4 150615322 unclassified probably benign
R0630:Rere UTSW 4 150619088 missense probably damaging 1.00
R0961:Rere UTSW 4 150615372 unclassified probably benign
R1164:Rere UTSW 4 150534884 missense unknown
R1424:Rere UTSW 4 150617038 missense probably damaging 1.00
R1542:Rere UTSW 4 150615942 missense probably damaging 1.00
R1652:Rere UTSW 4 150612065 unclassified probably benign
R1953:Rere UTSW 4 150616837 missense probably damaging 1.00
R1959:Rere UTSW 4 150468790 missense probably benign 0.23
R1966:Rere UTSW 4 150616873 missense probably damaging 1.00
R1975:Rere UTSW 4 150615733 missense probably damaging 0.99
R2070:Rere UTSW 4 150614590 unclassified probably benign
R2115:Rere UTSW 4 150612561 unclassified probably benign
R2144:Rere UTSW 4 150616931 missense probably damaging 0.99
R2969:Rere UTSW 4 150570216 missense unknown
R3699:Rere UTSW 4 150477362 critical splice acceptor site probably null
R3723:Rere UTSW 4 150468795 missense probably damaging 1.00
R3826:Rere UTSW 4 150470328 missense probably benign 0.42
R4234:Rere UTSW 4 150617405 missense probably damaging 1.00
R4512:Rere UTSW 4 150477452 missense unknown
R4798:Rere UTSW 4 150615167 unclassified probably benign
R4883:Rere UTSW 4 150616053 missense probably damaging 0.98
R4914:Rere UTSW 4 150619144 missense probably damaging 1.00
R4916:Rere UTSW 4 150619144 missense probably damaging 1.00
R4917:Rere UTSW 4 150619144 missense probably damaging 1.00
R4918:Rere UTSW 4 150619144 missense probably damaging 1.00
R4966:Rere UTSW 4 150613816 unclassified probably benign
R5172:Rere UTSW 4 150570269 missense unknown
R5643:Rere UTSW 4 150617243 missense probably damaging 1.00
R6058:Rere UTSW 4 150468798 missense probably damaging 1.00
R7112:Rere UTSW 4 150406604 missense probably benign
R7173:Rere UTSW 4 150468738 missense probably damaging 1.00
R7190:Rere UTSW 4 150610953 missense unknown
R7699:Rere UTSW 4 150617098 missense
R7990:Rere UTSW 4 150614870 missense unknown
R8070:Rere UTSW 4 150617375 missense probably damaging 1.00
R8101:Rere UTSW 4 150617339 missense probably damaging 1.00
R8103:Rere UTSW 4 150617339 missense probably damaging 1.00
R8215:Rere UTSW 4 150616967 missense possibly damaging 0.95
R8254:Rere UTSW 4 150612672 missense unknown
R8348:Rere UTSW 4 150619196 missense probably damaging 1.00
R8448:Rere UTSW 4 150619196 missense probably damaging 1.00
R8725:Rere UTSW 4 150617335 nonsense probably null
R8790:Rere UTSW 4 150508875 missense unknown
R8921:Rere UTSW 4 150612014 missense unknown
R8937:Rere UTSW 4 150614874 unclassified probably benign
R9345:Rere UTSW 4 150470313 missense probably damaging 0.99
R9377:Rere UTSW 4 150508885 missense unknown
Z1176:Rere UTSW 4 150468783 missense probably damaging 1.00
Z1177:Rere UTSW 4 150615811 missense
Predicted Primers PCR Primer
(F):5'- CTAGAGATGTTGCTATTCTCCTGTG -3'
(R):5'- CTGAGTCACTGCTTGGCATC -3'

Sequencing Primer
(F):5'- CTCCTGTGATACTTTATGGGGCTTAC -3'
(R):5'- CTGCTTGGCATCTAACTTAAGCACAG -3'
Posted On 2014-10-16