Incidental Mutation 'R2270:Cracr2a'
ID 242388
Institutional Source Beutler Lab
Gene Symbol Cracr2a
Ensembl Gene ENSMUSG00000061414
Gene Name calcium release activated channel regulator 2A
Synonyms LOC243645, Efcab4b, LOC381812
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2270 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 127561338-127674248 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127607298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 107 (F107I)
Ref Sequence ENSEMBL: ENSMUSP00000148569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]
AlphaFold Q3UP38
Predicted Effect probably damaging
Transcript: ENSMUST00000071563
AA Change: F107I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: F107I

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201303
SMART Domains Protein: ENSMUSP00000143930
Gene: ENSMUSG00000061414

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212051
AA Change: F107I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4759 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr741 G T 14: 50,486,037 C193F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rere T C 4: 150,477,380 S248P unknown Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slc1a2 T G 2: 102,735,994 L14R probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Cracr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Cracr2a APN 6 127629930 intron probably benign
PIT4812001:Cracr2a UTSW 6 127625870 missense probably damaging 1.00
R0111:Cracr2a UTSW 6 127604061 missense probably benign 0.00
R0180:Cracr2a UTSW 6 127604074 critical splice donor site probably null
R1612:Cracr2a UTSW 6 127603929 nonsense probably null
R1929:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2055:Cracr2a UTSW 6 127608601 nonsense probably null
R2272:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2915:Cracr2a UTSW 6 127611505 missense probably damaging 0.98
R4476:Cracr2a UTSW 6 127629819 missense probably benign 0.18
R4600:Cracr2a UTSW 6 127603888 missense probably benign 0.00
R4767:Cracr2a UTSW 6 127611507 missense probably damaging 0.98
R5256:Cracr2a UTSW 6 127604029 missense probably damaging 1.00
R5657:Cracr2a UTSW 6 127604007 missense probably damaging 1.00
R5729:Cracr2a UTSW 6 127607236 missense possibly damaging 0.88
R6437:Cracr2a UTSW 6 127631831 missense probably damaging 0.96
R6572:Cracr2a UTSW 6 127608752 splice site probably null
R6851:Cracr2a UTSW 6 127608716 missense probably damaging 1.00
R7177:Cracr2a UTSW 6 127608706 missense probably benign 0.00
R7616:Cracr2a UTSW 6 127608697 nonsense probably null
R7809:Cracr2a UTSW 6 127649962 missense probably benign
R8030:Cracr2a UTSW 6 127611423 missense probably damaging 0.96
R8084:Cracr2a UTSW 6 127639172 missense probably benign 0.26
R8731:Cracr2a UTSW 6 127625927 critical splice donor site probably null
R8867:Cracr2a UTSW 6 127629773 nonsense probably null
Z1177:Cracr2a UTSW 6 127607244 missense probably benign 0.02
Z1177:Cracr2a UTSW 6 127669063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCACCCAACAAAGGATTTC -3'
(R):5'- ACAGTCAAGGTGGGCACATG -3'

Sequencing Primer
(F):5'- GGAAGAGGTCACTCCAAGCTC -3'
(R):5'- TGAGAAGAGCCCAATAATCTACTC -3'
Posted On 2014-10-16