Mutagenetix > Incidental Mutations

Incidental Mutation 'R2270:Mybpc1'

242401

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

040270-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.855) question?

Stock #

R2270 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88551407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 106 (V106F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

AlphaFold

A0A571BEN1

Predicted Effect

probably benign
Transcript: ENSMUST00000119185
AA Change: V467F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: V467F

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121629
AA Change: V481F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: V481F

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156573
AA Change: V106F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: V106F

Domain	Start	End	E-Value	Type
PDB:1X44\|A	2	58	1e-26	PDB
IG	66	146	6.97e-3	SMART
IG	159	244	2.83e-3	SMART
FN3	247	330	4.28e-10	SMART
FN3	345	446	1.6e-9	SMART
low complexity region	458	470	N/A	INTRINSIC
IG	473	556	9.06e-2	SMART
FN3	559	617	8.17e0	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	G	A	19: 57,077,431	R54W	possibly damaging	Het
Adam22	T	C	5: 8,121,108	E614G	probably damaging	Het
Ap4e1	T	C	2: 127,047,163		probably null	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atp11b	A	G	3: 35,810,134		probably null	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Chat	T	C	14: 32,454,581	R79G	probably damaging	Het
Chek1	A	G	9: 36,719,686	L144P	probably damaging	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Crip2	A	C	12: 113,144,866	K62N	probably damaging	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnm3	A	T	1: 162,477,789	L12Q	probably damaging	Het
Eftud2	T	C	11: 102,864,781	N200S	probably damaging	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fgfbp1	T	A	5: 43,979,330	M207L	probably benign	Het
Fry	A	G	5: 150,400,924	I1151V	probably null	Het
Garem2	T	G	5: 30,116,974	L777R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gpr143	T	A	X: 152,790,570	V181E	probably damaging	Het
Gtf2f1	T	C	17: 57,003,462	I498V	probably null	Het
Ipo4	A	G	14: 55,634,100	L168P	probably damaging	Het
Ism1	T	A	2: 139,757,373	I415N	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mre11a	A	G	9: 14,815,174	E411G	probably benign	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
N4bp3	A	T	11: 51,644,305	N352K	probably benign	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Ncor2	A	G	5: 125,037,955	V515A	probably benign	Het
Ndufv1	C	A	19: 4,008,347	R359L	probably benign	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Olfm4	C	A	14: 80,011,875	T144K	probably damaging	Het
Olfr741	G	T	14: 50,486,037	C193F	probably damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Phf12	G	T	11: 77,984,175	A76S	possibly damaging	Het
Plb1	G	T	5: 32,293,242	D376Y	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prkg1	A	G	19: 30,578,631	V610A	probably benign	Het
Prrc2a	T	C	17: 35,149,536	T2104A	possibly damaging	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Ranbp2	T	C	10: 58,455,927	V252A	probably benign	Het
Rcn3	A	G	7: 45,088,651	S98P	probably damaging	Het
Rere	T	C	4: 150,477,380	S248P	unknown	Het
Rnaseh2a	T	C	8: 84,965,419	E75G	probably benign	Het
Slc15a1	A	T	14: 121,479,994	M292K	probably damaging	Het
Slc1a2	T	G	2: 102,735,994	L14R	probably damaging	Het
Slfn2	C	T	11: 83,069,935	R247C	probably damaging	Het
Ttn	T	C	2: 76,948,364	I1218M	probably damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Yme1l1	T	C	2: 23,175,220	I247T	possibly damaging	Het
Zc3h13	T	C	14: 75,332,147	M1478T	probably benign	Het
Zfp444	T	C	7: 6,189,555	C191R	probably damaging	Het
Zfp729b	A	T	13: 67,592,233	C648S	probably damaging	Het
Znhit2	A	G	19: 6,061,231	E2G	probably damaging	Het
Zpbp	A	T	11: 11,418,272	M133K	probably benign	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
R8494:Mybpc1	UTSW	10	88526429	missense	probably benign	0.01
R8849:Mybpc1	UTSW	10	88571585	missense	probably benign	0.01
R8936:Mybpc1	UTSW	10	88558575	missense	probably benign	0.44
R9031:Mybpc1	UTSW	10	88523044	missense	probably damaging	0.99
R9061:Mybpc1	UTSW	10	88555639	missense	probably damaging	1.00
R9081:Mybpc1	UTSW	10	88553306	missense	probably damaging	1.00
R9172:Mybpc1	UTSW	10	88543753	missense	possibly damaging	0.93
R9323:Mybpc1	UTSW	10	88524967	critical splice donor site	probably null
R9460:Mybpc1	UTSW	10	88536335	missense	probably damaging	0.99
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGATACGCCATGGTTTGAGG -3'
(R):5'- TGAAATGCCACCATGGTCGC -3'

Sequencing Primer
(F):5'- ACGCCATGGTTTGAGGTATAGATAC -3'
(R):5'- CACCATGGTCGCTTGTCTGG -3'

Posted On

2014-10-16