Incidental Mutation 'R2270:Olfr741'
ID242417
Institutional Source Beutler Lab
Gene Symbol Olfr741
Ensembl Gene ENSMUSG00000095765
Gene Nameolfactory receptor 741
SynonymsMOR106-15, MOR106-10, GA_x6K02T2PMLR-6197851-6198786
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2270 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50472738-50488338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50486037 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 193 (C193F)
Ref Sequence ENSEMBL: ENSMUSP00000151020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071932] [ENSMUST00000205518] [ENSMUST00000213903]
Predicted Effect probably damaging
Transcript: ENSMUST00000071932
AA Change: C193F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071824
Gene: ENSMUSG00000095765
AA Change: C193F

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.2e-55 PFAM
Pfam:7tm_1 45 294 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205518
AA Change: C193F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213903
AA Change: C193F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rere T C 4: 150,477,380 S248P unknown Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slc1a2 T G 2: 102,735,994 L14R probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Olfr741
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr741 APN 14 50485773 missense probably damaging 0.98
IGL01796:Olfr741 APN 14 50485541 missense probably benign 0.28
IGL01916:Olfr741 APN 14 50485493 missense probably benign 0.01
IGL02686:Olfr741 APN 14 50485969 missense probably benign 0.01
IGL02874:Olfr741 APN 14 50486229 missense possibly damaging 0.57
IGL02898:Olfr741 APN 14 50486186 missense probably damaging 1.00
PIT4515001:Olfr741 UTSW 14 50486079 missense probably benign 0.03
R0085:Olfr741 UTSW 14 50486334 missense probably benign 0.16
R1777:Olfr741 UTSW 14 50486300 missense probably benign 0.08
R1850:Olfr741 UTSW 14 50485598 missense probably benign
R2338:Olfr741 UTSW 14 50485640 missense possibly damaging 0.47
R2971:Olfr741 UTSW 14 50485608 missense probably damaging 0.99
R4594:Olfr741 UTSW 14 50486162 missense probably benign 0.00
R5383:Olfr741 UTSW 14 50486052 nonsense probably null
R5708:Olfr741 UTSW 14 50485995 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R7116:Olfr741 UTSW 14 50485568 missense probably benign 0.00
R7702:Olfr741 UTSW 14 50486294 missense possibly damaging 0.79
R8169:Olfr741 UTSW 14 50486235 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTTCTCTCATGACTGGGCG -3'
(R):5'- CCTCATGCTCAGATGTTGGG -3'

Sequencing Primer
(F):5'- GCCTCCGAAACACCCTTG -3'
(R):5'- CTCAGATGTTGGGCTCAGATAC -3'
Posted On2014-10-16