Mutagenetix > Incidental Mutations

Incidental Mutation 'R2270:Slc15a1'

242421

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

040270-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R2270 (G1)

Quality Score

182

Status

Not validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121479994 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 292 (M292K)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

Predicted Effect

probably damaging
Transcript: ENSMUST00000088386
AA Change: M292K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: M292K

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227372

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	G	A	19: 57,077,431	R54W	possibly damaging	Het
Adam22	T	C	5: 8,121,108	E614G	probably damaging	Het
Ap4e1	T	C	2: 127,047,163		probably null	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Arntl2	T	C	6: 146,822,114	F314S	probably damaging	Het
Atp11b	A	G	3: 35,810,134		probably null	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Chat	T	C	14: 32,454,581	R79G	probably damaging	Het
Chek1	A	G	9: 36,719,686	L144P	probably damaging	Het
Cracr2a	T	A	6: 127,607,298	F107I	probably damaging	Het
Crip2	A	C	12: 113,144,866	K62N	probably damaging	Het
Ddc	T	C	11: 11,835,764	N308D	probably damaging	Het
Dnm3	A	T	1: 162,477,789	L12Q	probably damaging	Het
Eftud2	T	C	11: 102,864,781	N200S	probably damaging	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fgfbp1	T	A	5: 43,979,330	M207L	probably benign	Het
Fry	A	G	5: 150,400,924	I1151V	probably null	Het
Garem2	T	G	5: 30,116,974	L777R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gpr143	T	A	X: 152,790,570	V181E	probably damaging	Het
Gtf2f1	T	C	17: 57,003,462	I498V	probably null	Het
Ipo4	A	G	14: 55,634,100	L168P	probably damaging	Het
Ism1	T	A	2: 139,757,373	I415N	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mre11a	A	G	9: 14,815,174	E411G	probably benign	Het
Mybpc1	C	A	10: 88,551,407	V106F	probably benign	Het
Myo5b	G	T	18: 74,733,925	L1382F	probably damaging	Het
N4bp3	A	T	11: 51,644,305	N352K	probably benign	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Ncor2	A	G	5: 125,037,955	V515A	probably benign	Het
Ndufv1	C	A	19: 4,008,347	R359L	probably benign	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Olfm4	C	A	14: 80,011,875	T144K	probably damaging	Het
Olfr741	G	T	14: 50,486,037	C193F	probably damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pes1	C	A	11: 3,969,524	L66I	probably damaging	Het
Phf12	G	T	11: 77,984,175	A76S	possibly damaging	Het
Plb1	G	T	5: 32,293,242	D376Y	probably damaging	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prkg1	A	G	19: 30,578,631	V610A	probably benign	Het
Prrc2a	T	C	17: 35,149,536	T2104A	possibly damaging	Het
Rab3gap2	T	A	1: 185,283,542		probably null	Het
Ranbp2	T	C	10: 58,455,927	V252A	probably benign	Het
Rcn3	A	G	7: 45,088,651	S98P	probably damaging	Het
Rere	T	C	4: 150,477,380	S248P	unknown	Het
Rnaseh2a	T	C	8: 84,965,419	E75G	probably benign	Het
Slc1a2	T	G	2: 102,735,994	L14R	probably damaging	Het
Slfn2	C	T	11: 83,069,935	R247C	probably damaging	Het
Ttn	T	C	2: 76,948,364	I1218M	probably damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Yme1l1	T	C	2: 23,175,220	I247T	possibly damaging	Het
Zc3h13	T	C	14: 75,332,147	M1478T	probably benign	Het
Zfp444	T	C	7: 6,189,555	C191R	probably damaging	Het
Zfp729b	A	T	13: 67,592,233	C648S	probably damaging	Het
Znhit2	A	G	19: 6,061,231	E2G	probably damaging	Het
Zpbp	A	T	11: 11,418,272	M133K	probably benign	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R7919:Slc15a1	UTSW	14	121480733	nonsense	probably null
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAACAAACCTCACTTTCTTCACTG -3'
(R):5'- TTTCCTAGAGAAACCCGCGC -3'

Sequencing Primer
(F):5'- CTGATTCACAATAGACATGCGG -3'
(R):5'- GCGCTCACATCCTTTAGACTGAC -3'

Posted On

2014-10-16