Incidental Mutation 'R0167:Uhrf1bp1'
ID24243
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0167 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27880202 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 246 (T246M)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114849
AA Change: T246M

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: T246M

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130810
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 splice site probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 splice site probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense probably damaging 1.00
R7158:Uhrf1bp1 UTSW 17 27886433 nonsense probably null
R8338:Uhrf1bp1 UTSW 17 27876695 missense probably damaging 1.00
RF005:Uhrf1bp1 UTSW 17 27885531 missense probably damaging 1.00
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Z1176:Uhrf1bp1 UTSW 17 27876676 missense probably damaging 1.00
Z1176:Uhrf1bp1 UTSW 17 27886306 missense probably damaging 1.00
Z1177:Uhrf1bp1 UTSW 17 27884966 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTTGGTATTGTGCCACTGTCCTC -3'
(R):5'- ATGTGGTGAACCCTATAAGCAAGCC -3'

Sequencing Primer
(F):5'- CCTCTCCATTGTGGGAGAAG -3'
(R):5'- GGCCTCCATTCCCCCAAC -3'
Posted On2013-04-16