Incidental Mutation 'R2271:Shc1'
ID 242451
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Name src homology 2 domain-containing transforming protein C1
Synonyms ShcA, p66shc, p66
MMRRC Submission 040271-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R2271 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 89418443-89430027 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89423542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 91 (G91S)
Ref Sequence ENSEMBL: ENSMUSP00000123635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039110] [ENSMUST00000094378] [ENSMUST00000107417] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000154791] [ENSMUST00000191485]
AlphaFold P98083
Predicted Effect probably benign
Transcript: ENSMUST00000039110
AA Change: G91S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626
AA Change: G91S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094378
AA Change: G201S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: G201S

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107417
AA Change: G46S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626
AA Change: G46S

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125036
AA Change: G35S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626
AA Change: G35S

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128238
AA Change: G91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626
AA Change: G91S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137793
AA Change: G91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626
AA Change: G91S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153334
Predicted Effect probably damaging
Transcript: ENSMUST00000154791
AA Change: G91S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626
AA Change: G91S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191485
AA Change: G91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626
AA Change: G91S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Meta Mutation Damage Score 0.7054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,981,579 Q194L probably damaging Het
Acsf2 T A 11: 94,558,873 K574* probably null Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc146 C A 5: 21,399,721 D40Y probably benign Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Chd7 A G 4: 8,785,532 D612G probably damaging Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cops6 A T 5: 138,161,141 N10I probably benign Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27a1 A G 1: 74,736,687 N344D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Disp3 C T 4: 148,271,602 R267Q possibly damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Dnajb14 G A 3: 137,885,380 G31S probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Efcab6 T A 15: 83,946,999 R571S probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Hps6 C T 19: 46,005,682 A686V possibly damaging Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mocs1 A T 17: 49,449,109 K198M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Neu3 G C 7: 99,813,443 R358G probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1045 A G 2: 86,197,817 F312L probably benign Het
Olfr351 G A 2: 36,859,625 S241F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pik3c2b T C 1: 133,103,428 S1491P probably benign Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plekhm1 C T 11: 103,387,122 E383K probably benign Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Ptprh C A 7: 4,603,133 probably benign Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Sacs A G 14: 61,204,660 H1385R probably benign Het
Sec24a A G 11: 51,716,450 S656P possibly damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sin3b T A 8: 72,733,419 N211K probably benign Het
Slc22a2 A T 17: 12,586,805 M148L probably benign Het
Slc3a1 G A 17: 85,063,792 V591I probably benign Het
Slc47a2 A T 11: 61,328,526 probably null Het
Spag17 C T 3: 100,106,797 P2129S probably damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Sphkap T A 1: 83,257,221 D1628V probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
U2surp T C 9: 95,491,420 E232G possibly damaging Het
Usp25 T A 16: 77,076,429 F458L probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r10 A G 6: 57,114,103 T227A probably damaging Het
Zcchc12 C T X: 36,198,465 T345M possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0445:Shc1 UTSW 3 89426537 missense probably damaging 1.00
R0827:Shc1 UTSW 3 89426783 splice site probably null
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R0836:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4402:Shc1 UTSW 3 89426678 missense probably benign
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6604:Shc1 UTSW 3 89421879 missense probably damaging 1.00
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
R8041:Shc1 UTSW 3 89422953 missense probably damaging 1.00
R8284:Shc1 UTSW 3 89421908 missense possibly damaging 0.70
R8700:Shc1 UTSW 3 89427433 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAGCCATTGAAGCCCTAACC -3'
(R):5'- GGCATTCCAGCAAACTTCAGG -3'

Sequencing Primer
(F):5'- CGGTGTCATCAAATATTAAAGGCCC -3'
(R):5'- GCATTCCAGCAAACTTCAGGTTACTC -3'
Posted On 2014-10-16