Incidental Mutation 'R2271:Disp3'
ID 242459
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Name dispatched RND transporter family member 3
Synonyms G630052C06Rik, Ptchd2
MMRRC Submission 040271-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2271 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 148324721-148372422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 148356059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 267 (R267Q)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047720
AA Change: R267Q

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: R267Q

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,857,575 (GRCm39) Q194L probably damaging Het
Acsf2 T A 11: 94,449,699 (GRCm39) K574* probably null Het
Adam22 T C 5: 8,171,108 (GRCm39) E614G probably damaging Het
Ap4e1 T C 2: 126,889,083 (GRCm39) probably null Het
Arid3c T A 4: 41,724,744 (GRCm39) I364F probably damaging Het
Bcan T A 3: 87,900,401 (GRCm39) S611C probably damaging Het
Birc6 T C 17: 74,909,966 (GRCm39) V1453A probably benign Het
Carnmt1 T C 19: 18,680,734 (GRCm39) L336P probably damaging Het
Ccdc146 C A 5: 21,604,719 (GRCm39) D40Y probably benign Het
Ccdc83 C T 7: 89,873,285 (GRCm39) V357I probably damaging Het
Cdh22 A T 2: 164,985,767 (GRCm39) probably null Het
Cdk5rap2 A C 4: 70,184,915 (GRCm39) S1178R probably benign Het
Cdkl3 T C 11: 51,923,322 (GRCm39) V45A probably benign Het
Chd7 A G 4: 8,785,532 (GRCm39) D612G probably damaging Het
Chst11 T C 10: 83,027,004 (GRCm39) Y144H probably damaging Het
Cops6 A T 5: 138,159,403 (GRCm39) N10I probably benign Het
Cyfip1 G T 7: 55,549,705 (GRCm39) R624L probably null Het
Cyp27a1 A G 1: 74,775,846 (GRCm39) N344D probably damaging Het
Des T G 1: 75,340,137 (GRCm39) M348R probably damaging Het
Dis3l T A 9: 64,238,165 (GRCm39) D109V probably damaging Het
Dnah3 T A 7: 119,574,352 (GRCm39) I2136F probably benign Het
Dnah9 T C 11: 66,003,188 (GRCm39) D872G probably benign Het
Dnajb14 G A 3: 137,591,141 (GRCm39) G31S probably benign Het
Dop1a T G 9: 86,376,471 (GRCm39) V235G probably damaging Het
Efcab6 T A 15: 83,831,200 (GRCm39) R571S probably benign Het
Emsy T G 7: 98,275,830 (GRCm39) K352N probably damaging Het
Erbb4 T C 1: 68,238,047 (GRCm39) N814S probably damaging Het
Fgfbp1 T A 5: 44,136,672 (GRCm39) M207L probably benign Het
Filip1 T C 9: 79,727,212 (GRCm39) E469G probably damaging Het
Garem2 T G 5: 30,321,972 (GRCm39) L777R probably damaging Het
Garin5b T A 7: 4,761,186 (GRCm39) T509S probably benign Het
Hkdc1 T C 10: 62,253,677 (GRCm39) T35A probably benign Het
Hps6 C T 19: 45,994,121 (GRCm39) A686V possibly damaging Het
Irs1 T C 1: 82,266,180 (GRCm39) S679G probably benign Het
Ism1 T A 2: 139,599,293 (GRCm39) I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,217,564 (GRCm39) probably null Het
Kpna1 G A 16: 35,851,591 (GRCm39) A392T probably damaging Het
Lipa T A 19: 34,488,290 (GRCm39) R119* probably null Het
Lrrc37 T C 11: 103,505,033 (GRCm39) T2312A possibly damaging Het
Mocs1 A T 17: 49,756,137 (GRCm39) K198M probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Msh5 A G 17: 35,263,366 (GRCm39) I154T probably benign Het
Muc6 T A 7: 141,217,423 (GRCm39) T2417S possibly damaging Het
Ncbp2 T C 16: 31,775,769 (GRCm39) Y138H probably damaging Het
Ndufv1 C A 19: 4,058,347 (GRCm39) R359L probably benign Het
Neu3 G C 7: 99,462,650 (GRCm39) R358G probably benign Het
Ntrk3 A C 7: 78,166,471 (GRCm39) probably null Het
Or1n1 G A 2: 36,749,637 (GRCm39) S241F probably damaging Het
Or8b12i T A 9: 20,082,705 (GRCm39) H54L possibly damaging Het
Or8j3 A G 2: 86,028,161 (GRCm39) F312L probably benign Het
Pik3c2b T C 1: 133,031,166 (GRCm39) S1491P probably benign Het
Plb1 G T 5: 32,450,586 (GRCm39) D376Y probably damaging Het
Plch1 T A 3: 63,651,956 (GRCm39) K378N probably damaging Het
Plekhm1 C T 11: 103,277,948 (GRCm39) E383K probably benign Het
Plxnb1 T C 9: 108,931,776 (GRCm39) probably null Het
Prkdc A G 16: 15,472,681 (GRCm39) probably null Het
Prpf8 T A 11: 75,386,189 (GRCm39) V946E probably damaging Het
Psma5-ps A G 10: 85,149,595 (GRCm39) noncoding transcript Het
Ptprh C A 7: 4,606,132 (GRCm39) probably benign Het
Rngtt T A 4: 33,500,302 (GRCm39) C565* probably null Het
Sacs A G 14: 61,442,109 (GRCm39) H1385R probably benign Het
Sec24a A G 11: 51,607,277 (GRCm39) S656P possibly damaging Het
Serpinb13 A T 1: 106,926,756 (GRCm39) I251L possibly damaging Het
Shc1 G A 3: 89,330,849 (GRCm39) G91S probably damaging Het
Sin3b T A 8: 73,460,047 (GRCm39) N211K probably benign Het
Slc22a2 A T 17: 12,805,692 (GRCm39) M148L probably benign Het
Slc3a1 G A 17: 85,371,220 (GRCm39) V591I probably benign Het
Slc47a2 A T 11: 61,219,352 (GRCm39) probably null Het
Spag17 C T 3: 100,014,113 (GRCm39) P2129S probably damaging Het
Specc1l C T 10: 75,081,438 (GRCm39) S278F probably damaging Het
Sphkap T A 1: 83,234,942 (GRCm39) D1628V probably damaging Het
Themis3 C T 17: 66,862,699 (GRCm39) V420I possibly damaging Het
Ttc39d A G 17: 80,524,675 (GRCm39) K445E probably damaging Het
U2surp T C 9: 95,373,473 (GRCm39) E232G possibly damaging Het
Usp25 T A 16: 76,873,317 (GRCm39) F458L probably damaging Het
Usp7 T C 16: 8,516,333 (GRCm39) S649G probably benign Het
Vmn1r10 A G 6: 57,091,088 (GRCm39) T227A probably damaging Het
Zcchc12 C T X: 35,462,118 (GRCm39) T345M possibly damaging Het
Zfp444 T C 7: 6,192,554 (GRCm39) C191R probably damaging Het
Zfp729b A T 13: 67,740,352 (GRCm39) C648S probably damaging Het
Zfp799 A G 17: 33,040,777 (GRCm39) Y58H probably damaging Het
Zfp938 C T 10: 82,061,381 (GRCm39) G413D probably damaging Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148,325,991 (GRCm39) missense probably benign 0.10
IGL01065:Disp3 APN 4 148,345,640 (GRCm39) missense probably damaging 1.00
IGL01800:Disp3 APN 4 148,334,258 (GRCm39) nonsense probably null
IGL01947:Disp3 APN 4 148,344,976 (GRCm39) missense probably damaging 1.00
IGL02510:Disp3 APN 4 148,337,158 (GRCm39) missense probably benign 0.00
IGL02573:Disp3 APN 4 148,355,906 (GRCm39) missense probably damaging 1.00
IGL02728:Disp3 APN 4 148,356,495 (GRCm39) missense probably damaging 1.00
IGL02931:Disp3 APN 4 148,333,658 (GRCm39) missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0257:Disp3 UTSW 4 148,335,211 (GRCm39) missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148,356,416 (GRCm39) missense probably damaging 1.00
R0557:Disp3 UTSW 4 148,325,861 (GRCm39) missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148,326,047 (GRCm39) missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148,334,282 (GRCm39) missense probably benign 0.00
R1526:Disp3 UTSW 4 148,344,373 (GRCm39) missense probably benign 0.00
R1791:Disp3 UTSW 4 148,325,975 (GRCm39) missense probably damaging 1.00
R1856:Disp3 UTSW 4 148,356,089 (GRCm39) missense probably damaging 1.00
R1987:Disp3 UTSW 4 148,343,210 (GRCm39) missense probably damaging 0.97
R2030:Disp3 UTSW 4 148,344,423 (GRCm39) missense probably damaging 1.00
R2373:Disp3 UTSW 4 148,343,252 (GRCm39) missense probably damaging 1.00
R2566:Disp3 UTSW 4 148,325,880 (GRCm39) missense probably damaging 1.00
R3731:Disp3 UTSW 4 148,337,284 (GRCm39) missense probably benign 0.03
R4359:Disp3 UTSW 4 148,356,389 (GRCm39) missense probably benign 0.03
R4762:Disp3 UTSW 4 148,356,575 (GRCm39) missense probably damaging 1.00
R4950:Disp3 UTSW 4 148,342,583 (GRCm39) missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148,328,673 (GRCm39) missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148,327,333 (GRCm39) missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148,342,554 (GRCm39) missense probably benign 0.14
R5556:Disp3 UTSW 4 148,342,614 (GRCm39) missense probably benign 0.14
R5857:Disp3 UTSW 4 148,333,640 (GRCm39) missense probably benign 0.01
R5933:Disp3 UTSW 4 148,325,770 (GRCm39) nonsense probably null
R5994:Disp3 UTSW 4 148,338,741 (GRCm39) missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148,338,765 (GRCm39) missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148,344,387 (GRCm39) missense probably benign 0.09
R7211:Disp3 UTSW 4 148,325,979 (GRCm39) missense probably damaging 0.98
R7470:Disp3 UTSW 4 148,345,527 (GRCm39) missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148,327,323 (GRCm39) missense probably damaging 0.99
R8093:Disp3 UTSW 4 148,354,973 (GRCm39) missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148,326,027 (GRCm39) missense possibly damaging 0.77
R9182:Disp3 UTSW 4 148,354,841 (GRCm39) missense probably damaging 1.00
R9219:Disp3 UTSW 4 148,334,317 (GRCm39) missense possibly damaging 0.74
R9680:Disp3 UTSW 4 148,356,101 (GRCm39) missense probably damaging 1.00
R9696:Disp3 UTSW 4 148,345,611 (GRCm39) missense probably damaging 0.97
Z1088:Disp3 UTSW 4 148,356,200 (GRCm39) missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148,335,414 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,335,171 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,334,304 (GRCm39) missense probably benign 0.01
Z1177:Disp3 UTSW 4 148,334,203 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,355,024 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCCACAGACATCTTGCATG -3'
(R):5'- GGATTACTCGCGCACCTATG -3'

Sequencing Primer
(F):5'- AGCATAGTACCGTTCCATCAGTGTG -3'
(R):5'- GCACCTATGTGAGCGCCAAC -3'
Posted On 2014-10-16