Incidental Mutation 'R2271:Neu3'
ID 242476
Institutional Source Beutler Lab
Gene Symbol Neu3
Ensembl Gene ENSMUSG00000035239
Gene Name neuraminidase 3
Synonyms ganglioside sialidase, membrane sialidase
MMRRC Submission 040271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R2271 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 99811439-99828417 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 99813443 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 358 (R358G)
Ref Sequence ENSEMBL: ENSMUSP00000045222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036331]
AlphaFold Q9JMH7
Predicted Effect probably benign
Transcript: ENSMUST00000036331
AA Change: R358G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045222
Gene: ENSMUSG00000035239
AA Change: R358G

DomainStartEndE-ValueType
Pfam:BNR_2 36 382 6.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. It is localized in the plasma membrane, and its activity is specific for gangliosides. It may play a role in modulating the ganglioside content of the lipid bilayer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased colon carcinogenesis induced by azoxymethane and dextran sodium sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,981,579 Q194L probably damaging Het
Acsf2 T A 11: 94,558,873 K574* probably null Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc146 C A 5: 21,399,721 D40Y probably benign Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Chd7 A G 4: 8,785,532 D612G probably damaging Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cops6 A T 5: 138,161,141 N10I probably benign Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27a1 A G 1: 74,736,687 N344D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Disp3 C T 4: 148,271,602 R267Q possibly damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Dnajb14 G A 3: 137,885,380 G31S probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Efcab6 T A 15: 83,946,999 R571S probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Hps6 C T 19: 46,005,682 A686V possibly damaging Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mocs1 A T 17: 49,449,109 K198M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1045 A G 2: 86,197,817 F312L probably benign Het
Olfr351 G A 2: 36,859,625 S241F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pik3c2b T C 1: 133,103,428 S1491P probably benign Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plekhm1 C T 11: 103,387,122 E383K probably benign Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Ptprh C A 7: 4,603,133 probably benign Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Sacs A G 14: 61,204,660 H1385R probably benign Het
Sec24a A G 11: 51,716,450 S656P possibly damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Sin3b T A 8: 72,733,419 N211K probably benign Het
Slc22a2 A T 17: 12,586,805 M148L probably benign Het
Slc3a1 G A 17: 85,063,792 V591I probably benign Het
Slc47a2 A T 11: 61,328,526 probably null Het
Spag17 C T 3: 100,106,797 P2129S probably damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Sphkap T A 1: 83,257,221 D1628V probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
U2surp T C 9: 95,491,420 E232G possibly damaging Het
Usp25 T A 16: 77,076,429 F458L probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r10 A G 6: 57,114,103 T227A probably damaging Het
Zcchc12 C T X: 36,198,465 T345M possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Neu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Neu3 APN 7 99813880 missense probably benign 0.00
IGL01338:Neu3 APN 7 99813422 missense probably damaging 1.00
IGL01530:Neu3 APN 7 99813746 missense probably benign 0.00
R0395:Neu3 UTSW 7 99813778 missense probably benign
R0519:Neu3 UTSW 7 99823317 splice site probably benign
R0555:Neu3 UTSW 7 99814183 missense probably damaging 1.00
R1659:Neu3 UTSW 7 99813433 missense probably damaging 0.99
R1706:Neu3 UTSW 7 99823356 missense probably damaging 0.99
R1893:Neu3 UTSW 7 99823420 missense possibly damaging 0.81
R2472:Neu3 UTSW 7 99813407 missense probably damaging 1.00
R4962:Neu3 UTSW 7 99823408 missense probably damaging 1.00
R5589:Neu3 UTSW 7 99823429 missense probably benign 0.01
R5932:Neu3 UTSW 7 99813318 nonsense probably null
R6307:Neu3 UTSW 7 99813722 missense probably benign
R7072:Neu3 UTSW 7 99814197 nonsense probably null
R7099:Neu3 UTSW 7 99813820 missense possibly damaging 0.51
R7582:Neu3 UTSW 7 99813967 missense probably benign 0.02
R8057:Neu3 UTSW 7 99814228 missense probably benign 0.08
R8497:Neu3 UTSW 7 99823135 splice site probably null
X0023:Neu3 UTSW 7 99813604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCGCTACTAGGGCTGGTAC -3'
(R):5'- GGCCTTTGAAGATGCCAAATACC -3'

Sequencing Primer
(F):5'- TGGTACAGTCTTCACAGCTCAGG -3'
(R):5'- CTATCAAGACTCAATTGGCAAAGGTG -3'
Posted On 2014-10-16