Incidental Mutation 'R2271:Muc6'
ID 242478
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Name mucin 6, gastric
Synonyms
MMRRC Submission 040271-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R2271 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 141213373-141241641 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 141217423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 2417 (T2417S)
Ref Sequence ENSEMBL: ENSMUSP00000140483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000003038
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062451
AA Change: T2352S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: T2352S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190907
AA Change: T2417S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: T2417S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,857,575 (GRCm39) Q194L probably damaging Het
Acsf2 T A 11: 94,449,699 (GRCm39) K574* probably null Het
Adam22 T C 5: 8,171,108 (GRCm39) E614G probably damaging Het
Ap4e1 T C 2: 126,889,083 (GRCm39) probably null Het
Arid3c T A 4: 41,724,744 (GRCm39) I364F probably damaging Het
Bcan T A 3: 87,900,401 (GRCm39) S611C probably damaging Het
Birc6 T C 17: 74,909,966 (GRCm39) V1453A probably benign Het
Carnmt1 T C 19: 18,680,734 (GRCm39) L336P probably damaging Het
Ccdc146 C A 5: 21,604,719 (GRCm39) D40Y probably benign Het
Ccdc83 C T 7: 89,873,285 (GRCm39) V357I probably damaging Het
Cdh22 A T 2: 164,985,767 (GRCm39) probably null Het
Cdk5rap2 A C 4: 70,184,915 (GRCm39) S1178R probably benign Het
Cdkl3 T C 11: 51,923,322 (GRCm39) V45A probably benign Het
Chd7 A G 4: 8,785,532 (GRCm39) D612G probably damaging Het
Chst11 T C 10: 83,027,004 (GRCm39) Y144H probably damaging Het
Cops6 A T 5: 138,159,403 (GRCm39) N10I probably benign Het
Cyfip1 G T 7: 55,549,705 (GRCm39) R624L probably null Het
Cyp27a1 A G 1: 74,775,846 (GRCm39) N344D probably damaging Het
Des T G 1: 75,340,137 (GRCm39) M348R probably damaging Het
Dis3l T A 9: 64,238,165 (GRCm39) D109V probably damaging Het
Disp3 C T 4: 148,356,059 (GRCm39) R267Q possibly damaging Het
Dnah3 T A 7: 119,574,352 (GRCm39) I2136F probably benign Het
Dnah9 T C 11: 66,003,188 (GRCm39) D872G probably benign Het
Dnajb14 G A 3: 137,591,141 (GRCm39) G31S probably benign Het
Dop1a T G 9: 86,376,471 (GRCm39) V235G probably damaging Het
Efcab6 T A 15: 83,831,200 (GRCm39) R571S probably benign Het
Emsy T G 7: 98,275,830 (GRCm39) K352N probably damaging Het
Erbb4 T C 1: 68,238,047 (GRCm39) N814S probably damaging Het
Fgfbp1 T A 5: 44,136,672 (GRCm39) M207L probably benign Het
Filip1 T C 9: 79,727,212 (GRCm39) E469G probably damaging Het
Garem2 T G 5: 30,321,972 (GRCm39) L777R probably damaging Het
Garin5b T A 7: 4,761,186 (GRCm39) T509S probably benign Het
Hkdc1 T C 10: 62,253,677 (GRCm39) T35A probably benign Het
Hps6 C T 19: 45,994,121 (GRCm39) A686V possibly damaging Het
Irs1 T C 1: 82,266,180 (GRCm39) S679G probably benign Het
Ism1 T A 2: 139,599,293 (GRCm39) I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,217,564 (GRCm39) probably null Het
Kpna1 G A 16: 35,851,591 (GRCm39) A392T probably damaging Het
Lipa T A 19: 34,488,290 (GRCm39) R119* probably null Het
Lrrc37 T C 11: 103,505,033 (GRCm39) T2312A possibly damaging Het
Mocs1 A T 17: 49,756,137 (GRCm39) K198M probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Msh5 A G 17: 35,263,366 (GRCm39) I154T probably benign Het
Ncbp2 T C 16: 31,775,769 (GRCm39) Y138H probably damaging Het
Ndufv1 C A 19: 4,058,347 (GRCm39) R359L probably benign Het
Neu3 G C 7: 99,462,650 (GRCm39) R358G probably benign Het
Ntrk3 A C 7: 78,166,471 (GRCm39) probably null Het
Or1n1 G A 2: 36,749,637 (GRCm39) S241F probably damaging Het
Or8b12i T A 9: 20,082,705 (GRCm39) H54L possibly damaging Het
Or8j3 A G 2: 86,028,161 (GRCm39) F312L probably benign Het
Pik3c2b T C 1: 133,031,166 (GRCm39) S1491P probably benign Het
Plb1 G T 5: 32,450,586 (GRCm39) D376Y probably damaging Het
Plch1 T A 3: 63,651,956 (GRCm39) K378N probably damaging Het
Plekhm1 C T 11: 103,277,948 (GRCm39) E383K probably benign Het
Plxnb1 T C 9: 108,931,776 (GRCm39) probably null Het
Prkdc A G 16: 15,472,681 (GRCm39) probably null Het
Prpf8 T A 11: 75,386,189 (GRCm39) V946E probably damaging Het
Psma5-ps A G 10: 85,149,595 (GRCm39) noncoding transcript Het
Ptprh C A 7: 4,606,132 (GRCm39) probably benign Het
Rngtt T A 4: 33,500,302 (GRCm39) C565* probably null Het
Sacs A G 14: 61,442,109 (GRCm39) H1385R probably benign Het
Sec24a A G 11: 51,607,277 (GRCm39) S656P possibly damaging Het
Serpinb13 A T 1: 106,926,756 (GRCm39) I251L possibly damaging Het
Shc1 G A 3: 89,330,849 (GRCm39) G91S probably damaging Het
Sin3b T A 8: 73,460,047 (GRCm39) N211K probably benign Het
Slc22a2 A T 17: 12,805,692 (GRCm39) M148L probably benign Het
Slc3a1 G A 17: 85,371,220 (GRCm39) V591I probably benign Het
Slc47a2 A T 11: 61,219,352 (GRCm39) probably null Het
Spag17 C T 3: 100,014,113 (GRCm39) P2129S probably damaging Het
Specc1l C T 10: 75,081,438 (GRCm39) S278F probably damaging Het
Sphkap T A 1: 83,234,942 (GRCm39) D1628V probably damaging Het
Themis3 C T 17: 66,862,699 (GRCm39) V420I possibly damaging Het
Ttc39d A G 17: 80,524,675 (GRCm39) K445E probably damaging Het
U2surp T C 9: 95,373,473 (GRCm39) E232G possibly damaging Het
Usp25 T A 16: 76,873,317 (GRCm39) F458L probably damaging Het
Usp7 T C 16: 8,516,333 (GRCm39) S649G probably benign Het
Vmn1r10 A G 6: 57,091,088 (GRCm39) T227A probably damaging Het
Zcchc12 C T X: 35,462,118 (GRCm39) T345M possibly damaging Het
Zfp444 T C 7: 6,192,554 (GRCm39) C191R probably damaging Het
Zfp729b A T 13: 67,740,352 (GRCm39) C648S probably damaging Het
Zfp799 A G 17: 33,040,777 (GRCm39) Y58H probably damaging Het
Zfp938 C T 10: 82,061,381 (GRCm39) G413D probably damaging Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL00466:Muc6 APN 7 141,232,169 (GRCm39) missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141,638,890 (GRCm38) missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141,234,333 (GRCm39) nonsense probably null
IGL01021:Muc6 APN 7 141,217,075 (GRCm39) missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141,234,720 (GRCm39) missense probably damaging 1.00
IGL01294:Muc6 APN 7 141,232,926 (GRCm39) missense probably damaging 1.00
IGL01449:Muc6 APN 7 141,218,527 (GRCm39) missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141,237,572 (GRCm39) missense probably damaging 1.00
IGL01539:Muc6 APN 7 141,236,306 (GRCm39) missense probably benign 0.07
IGL01541:Muc6 APN 7 141,236,069 (GRCm39) nonsense probably null
IGL01810:Muc6 APN 7 141,237,327 (GRCm39) missense probably damaging 0.97
IGL01941:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL01954:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL02096:Muc6 APN 7 141,226,117 (GRCm39) intron probably benign
IGL02192:Muc6 APN 7 141,217,717 (GRCm39) missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141,235,889 (GRCm39) missense probably damaging 1.00
IGL02234:Muc6 APN 7 141,226,842 (GRCm39) missense probably benign 0.09
IGL02302:Muc6 APN 7 141,227,763 (GRCm39) missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141,226,726 (GRCm39) missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141,216,853 (GRCm39) missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141,235,843 (GRCm39) splice site probably benign
IGL02851:Muc6 APN 7 141,234,627 (GRCm39) missense probably damaging 1.00
IGL03026:Muc6 APN 7 141,226,414 (GRCm39) intron probably benign
IGL03070:Muc6 APN 7 141,230,834 (GRCm39) splice site probably benign
IGL03108:Muc6 APN 7 141,217,402 (GRCm39) missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141,238,324 (GRCm39) missense probably damaging 1.00
IGL03366:Muc6 APN 7 141,234,349 (GRCm39) missense probably damaging 1.00
anticipation UTSW 7 141,214,363 (GRCm39) frame shift probably null
F5770:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R0153:Muc6 UTSW 7 141,214,029 (GRCm39) missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141,216,868 (GRCm39) missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141,238,548 (GRCm39) missense probably benign 0.01
R0499:Muc6 UTSW 7 141,226,735 (GRCm39) missense probably benign
R0503:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141,218,497 (GRCm39) missense probably benign 0.06
R0792:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0880:Muc6 UTSW 7 141,217,270 (GRCm39) missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141,230,500 (GRCm39) missense probably damaging 0.99
R1174:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1175:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1189:Muc6 UTSW 7 141,232,122 (GRCm39) missense probably damaging 1.00
R1259:Muc6 UTSW 7 141,226,464 (GRCm39) intron probably benign
R1293:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R1295:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1296:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1471:Muc6 UTSW 7 141,234,176 (GRCm39) missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1548:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1548:Muc6 UTSW 7 141,238,368 (GRCm39) splice site probably benign
R1576:Muc6 UTSW 7 141,214,437 (GRCm39) missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141,234,265 (GRCm39) missense probably damaging 1.00
R1702:Muc6 UTSW 7 141,236,752 (GRCm39) missense probably damaging 1.00
R1792:Muc6 UTSW 7 141,214,371 (GRCm39) missense probably benign 0.41
R1924:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141,217,011 (GRCm39) missense probably damaging 0.99
R1964:Muc6 UTSW 7 141,226,330 (GRCm39) intron probably benign
R1964:Muc6 UTSW 7 141,226,329 (GRCm39) nonsense probably null
R1975:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R2031:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141,213,991 (GRCm39) missense probably benign 0.23
R2201:Muc6 UTSW 7 141,236,075 (GRCm39) missense probably damaging 1.00
R2218:Muc6 UTSW 7 141,233,227 (GRCm39) missense probably benign 0.41
R2245:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2272:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141,217,837 (GRCm39) missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141,217,444 (GRCm39) missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141,226,651 (GRCm39) missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141,216,951 (GRCm39) missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141,234,946 (GRCm39) splice site probably benign
R3872:Muc6 UTSW 7 141,226,867 (GRCm39) missense probably benign
R4029:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141,234,920 (GRCm39) missense probably damaging 1.00
R4126:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141,217,576 (GRCm39) missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141,226,356 (GRCm39) intron probably benign
R4509:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141,230,489 (GRCm39) missense probably benign 0.03
R4594:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141,224,212 (GRCm39) intron probably benign
R4678:Muc6 UTSW 7 141,230,554 (GRCm39) missense probably benign 0.09
R4737:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4737:Muc6 UTSW 7 141,226,426 (GRCm39) intron probably benign
R4981:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5012:Muc6 UTSW 7 141,216,570 (GRCm39) missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141,226,795 (GRCm39) missense probably benign
R5027:Muc6 UTSW 7 141,216,349 (GRCm39) missense probably benign 0.01
R5058:Muc6 UTSW 7 141,230,491 (GRCm39) missense probably benign 0.01
R5069:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5126:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5168:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5179:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141,237,375 (GRCm39) missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141,217,836 (GRCm39) missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141,235,078 (GRCm39) missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141,216,448 (GRCm39) missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141,235,850 (GRCm39) critical splice donor site probably null
R5800:Muc6 UTSW 7 141,226,690 (GRCm39) splice site probably benign
R5808:Muc6 UTSW 7 141,226,360 (GRCm39) intron probably benign
R5865:Muc6 UTSW 7 141,236,769 (GRCm39) missense probably damaging 0.97
R5919:Muc6 UTSW 7 141,227,837 (GRCm39) missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141,234,640 (GRCm39) missense probably damaging 1.00
R6126:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141,226,792 (GRCm39) missense probably benign
R6236:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141,235,086 (GRCm39) missense probably damaging 1.00
R6254:Muc6 UTSW 7 141,237,380 (GRCm39) missense probably benign 0.09
R6418:Muc6 UTSW 7 141,224,032 (GRCm39) intron probably benign
R6609:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6610:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6611:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6623:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6626:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6817:Muc6 UTSW 7 141,237,326 (GRCm39) missense probably damaging 0.99
R6923:Muc6 UTSW 7 141,217,453 (GRCm39) missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141,226,246 (GRCm39) intron probably benign
R7001:Muc6 UTSW 7 141,217,320 (GRCm39) missense probably damaging 0.99
R7046:Muc6 UTSW 7 141,226,456 (GRCm39) intron probably benign
R7097:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7099:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7101:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7107:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7108:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7112:Muc6 UTSW 7 141,235,542 (GRCm39) missense probably damaging 1.00
R7202:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7204:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7205:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7222:Muc6 UTSW 7 141,214,428 (GRCm39) missense unknown
R7230:Muc6 UTSW 7 141,235,479 (GRCm39) missense probably damaging 1.00
R7278:Muc6 UTSW 7 141,226,842 (GRCm39) missense probably benign 0.09
R7483:Muc6 UTSW 7 141,224,245 (GRCm39) missense unknown
R7501:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7601:Muc6 UTSW 7 141,216,454 (GRCm39) missense unknown
R7641:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7644:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7645:Muc6 UTSW 7 141,234,923 (GRCm39) missense probably benign 0.40
R7659:Muc6 UTSW 7 141,216,973 (GRCm39) missense possibly damaging 0.53
R7674:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7679:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7680:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7689:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7690:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7760:Muc6 UTSW 7 141,237,322 (GRCm39) splice site probably null
R7806:Muc6 UTSW 7 141,217,387 (GRCm39) missense possibly damaging 0.53
R7809:Muc6 UTSW 7 141,226,638 (GRCm39) missense probably benign 0.02
R7848:Muc6 UTSW 7 141,232,188 (GRCm39) missense possibly damaging 0.53
R7859:Muc6 UTSW 7 141,231,687 (GRCm39) missense probably damaging 0.96
R8054:Muc6 UTSW 7 141,231,748 (GRCm39) missense probably damaging 1.00
R8085:Muc6 UTSW 7 141,226,729 (GRCm39) missense unknown
R8130:Muc6 UTSW 7 141,233,354 (GRCm39) missense probably damaging 0.97
R8210:Muc6 UTSW 7 141,235,673 (GRCm39) critical splice donor site probably null
R8273:Muc6 UTSW 7 141,226,795 (GRCm39) missense unknown
R8294:Muc6 UTSW 7 141,217,263 (GRCm39) missense possibly damaging 0.96
R8329:Muc6 UTSW 7 141,226,525 (GRCm39) missense unknown
R8379:Muc6 UTSW 7 141,230,579 (GRCm39) nonsense probably null
R8537:Muc6 UTSW 7 141,234,184 (GRCm39) missense probably benign 0.03
R8736:Muc6 UTSW 7 141,228,439 (GRCm39) missense possibly damaging 0.53
R8767:Muc6 UTSW 7 141,229,549 (GRCm39) missense probably damaging 1.00
R8902:Muc6 UTSW 7 141,233,791 (GRCm39) missense possibly damaging 0.93
R9009:Muc6 UTSW 7 141,217,018 (GRCm39) missense possibly damaging 0.73
R9010:Muc6 UTSW 7 141,226,351 (GRCm39) missense unknown
R9023:Muc6 UTSW 7 141,237,432 (GRCm39) nonsense probably null
R9058:Muc6 UTSW 7 141,218,154 (GRCm39) missense possibly damaging 0.61
R9257:Muc6 UTSW 7 141,226,738 (GRCm39) missense unknown
R9495:Muc6 UTSW 7 141,237,398 (GRCm39) missense probably damaging 0.98
R9563:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9645:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9659:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
R9733:Muc6 UTSW 7 141,216,310 (GRCm39) missense unknown
R9787:Muc6 UTSW 7 141,227,748 (GRCm39) nonsense probably null
R9788:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
V7581:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
V7583:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
X0026:Muc6 UTSW 7 141,237,964 (GRCm39) missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
Z1177:Muc6 UTSW 7 141,237,656 (GRCm39) missense probably benign 0.20
Z1177:Muc6 UTSW 7 141,236,701 (GRCm39) missense probably benign 0.29
Z1177:Muc6 UTSW 7 141,217,827 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TACAGGACCTGCTGTGGATTG -3'
(R):5'- TCAGGCACATCTAGCATCGC -3'

Sequencing Primer
(F):5'- ACCTGCTGTGGATTGATGGAC -3'
(R):5'- ACAGCGGCTTCCTCCAG -3'
Posted On 2014-10-16