Incidental Mutation 'R2271:Specc1l'
ID242489
Institutional Source Beutler Lab
Gene Symbol Specc1l
Ensembl Gene ENSMUSG00000033444
Gene Namesperm antigen with calponin homology and coiled-coil domains 1-like
SynonymsCytsa, Specc1l
MMRRC Submission 040271-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R2271 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75212073-75312743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75245604 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 278 (S278F)
Ref Sequence ENSEMBL: ENSMUSP00000151322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766] [ENSMUST00000219387]
Predicted Effect probably damaging
Transcript: ENSMUST00000040105
AA Change: S295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: S295F

DomainStartEndE-ValueType
low complexity region 97 107 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
coiled coil region 255 298 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
coiled coil region 412 467 N/A INTRINSIC
coiled coil region 505 825 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 989 1010 N/A INTRINSIC
CH 1031 1129 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105421
AA Change: S295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: S295F

DomainStartEndE-ValueType
low complexity region 80 90 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
coiled coil region 238 281 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
coiled coil region 395 450 N/A INTRINSIC
coiled coil region 488 808 N/A INTRINSIC
low complexity region 829 841 N/A INTRINSIC
low complexity region 972 993 N/A INTRINSIC
CH 1014 1112 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218766
AA Change: S278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218876
Predicted Effect probably benign
Transcript: ENSMUST00000219387
Meta Mutation Damage Score 0.4350 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,981,579 Q194L probably damaging Het
Acsf2 T A 11: 94,558,873 K574* probably null Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc146 C A 5: 21,399,721 D40Y probably benign Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Chd7 A G 4: 8,785,532 D612G probably damaging Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cops6 A T 5: 138,161,141 N10I probably benign Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27a1 A G 1: 74,736,687 N344D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Disp3 C T 4: 148,271,602 R267Q possibly damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Dnajb14 G A 3: 137,885,380 G31S probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Efcab6 T A 15: 83,946,999 R571S probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Hps6 C T 19: 46,005,682 A686V possibly damaging Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mocs1 A T 17: 49,449,109 K198M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Neu3 G C 7: 99,813,443 R358G probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1045 A G 2: 86,197,817 F312L probably benign Het
Olfr351 G A 2: 36,859,625 S241F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pik3c2b T C 1: 133,103,428 S1491P probably benign Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plekhm1 C T 11: 103,387,122 E383K probably benign Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Ptprh C A 7: 4,603,133 probably benign Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Sacs A G 14: 61,204,660 H1385R probably benign Het
Sec24a A G 11: 51,716,450 S656P possibly damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Sin3b T A 8: 72,733,419 N211K probably benign Het
Slc22a2 A T 17: 12,586,805 M148L probably benign Het
Slc3a1 G A 17: 85,063,792 V591I probably benign Het
Slc47a2 A T 11: 61,328,526 probably null Het
Spag17 C T 3: 100,106,797 P2129S probably damaging Het
Sphkap T A 1: 83,257,221 D1628V probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
U2surp T C 9: 95,491,420 E232G possibly damaging Het
Usp25 T A 16: 77,076,429 F458L probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r10 A G 6: 57,114,103 T227A probably damaging Het
Zcchc12 C T X: 36,198,465 T345M possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Specc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Specc1l APN 10 75246221 missense probably benign 0.12
IGL01638:Specc1l APN 10 75246205 nonsense probably null
IGL01970:Specc1l APN 10 75245761 missense probably damaging 1.00
IGL02539:Specc1l APN 10 75267508 missense probably benign 0.39
IGL02737:Specc1l APN 10 75246324 missense probably damaging 0.99
IGL02941:Specc1l APN 10 75241188 missense probably benign 0.10
R0305:Specc1l UTSW 10 75245829 missense probably damaging 1.00
R0374:Specc1l UTSW 10 75248459 missense probably damaging 0.99
R0402:Specc1l UTSW 10 75246426 missense probably damaging 1.00
R1456:Specc1l UTSW 10 75246284 missense probably damaging 0.98
R1508:Specc1l UTSW 10 75307238 missense probably benign 0.00
R1861:Specc1l UTSW 10 75309859 missense probably damaging 1.00
R1869:Specc1l UTSW 10 75261825 missense probably damaging 1.00
R1929:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R1930:Specc1l UTSW 10 75309824 missense probably damaging 1.00
R2021:Specc1l UTSW 10 75267591 critical splice donor site probably null
R2209:Specc1l UTSW 10 75246576 missense probably damaging 1.00
R2937:Specc1l UTSW 10 75259131 missense probably damaging 0.98
R4415:Specc1l UTSW 10 75246328 missense possibly damaging 0.92
R4758:Specc1l UTSW 10 75246348 missense probably damaging 0.99
R5344:Specc1l UTSW 10 75246173 missense possibly damaging 0.84
R5383:Specc1l UTSW 10 75246705 missense possibly damaging 0.86
R5426:Specc1l UTSW 10 75267550 missense probably benign 0.21
R5774:Specc1l UTSW 10 75245400 missense probably damaging 1.00
R5788:Specc1l UTSW 10 75276921 missense probably damaging 1.00
R6101:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6105:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6136:Specc1l UTSW 10 75246660 missense probably benign 0.38
R6345:Specc1l UTSW 10 75248488 missense probably damaging 0.99
R6459:Specc1l UTSW 10 75246167 missense probably damaging 1.00
R6641:Specc1l UTSW 10 75246549 missense probably damaging 1.00
R6996:Specc1l UTSW 10 75246279 missense probably benign 0.23
R7100:Specc1l UTSW 10 75245495 missense probably benign 0.21
R7475:Specc1l UTSW 10 75246447 missense possibly damaging 0.59
R7545:Specc1l UTSW 10 75245087 missense probably benign 0.00
R7615:Specc1l UTSW 10 75263286 missense probably benign 0.02
R7635:Specc1l UTSW 10 75276804 missense probably damaging 1.00
R7640:Specc1l UTSW 10 75257869 missense probably damaging 1.00
R7682:Specc1l UTSW 10 75245802 missense probably damaging 0.99
R7711:Specc1l UTSW 10 75230808 missense probably benign 0.02
R7742:Specc1l UTSW 10 75246417 missense probably benign 0.01
X0021:Specc1l UTSW 10 75274040 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCATTAGTGAGGACCATTGTG -3'
(R):5'- TCCAGGTTGTCCATGGAGTTAC -3'

Sequencing Primer
(F):5'- CATTAGTGAGGACCATTGTGAAGGTG -3'
(R):5'- ACTGTGCTGATGGTCCATGAG -3'
Posted On2014-10-16