Mutagenetix > Incidental Mutations

Incidental Mutation 'R2271:Specc1l'

242489

Institutional Source

Beutler Lab

Gene Symbol

Specc1l

Ensembl Gene

ENSMUSG00000033444

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1-like

Synonyms

Cytsa, Specc1l

MMRRC Submission

040271-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.611) question?

Stock #

R2271 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75212073-75312743 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75245604 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 278 (S278F)

Ref Sequence

ENSEMBL: ENSMUSP00000151322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766] [ENSMUST00000219387]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040105
AA Change: S295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: S295F

Domain	Start	End	E-Value	Type
low complexity region	97	107	N/A	INTRINSIC
low complexity region	135	149	N/A	INTRINSIC
coiled coil region	255	298	N/A	INTRINSIC
low complexity region	376	390	N/A	INTRINSIC
coiled coil region	412	467	N/A	INTRINSIC
coiled coil region	505	825	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	989	1010	N/A	INTRINSIC
CH	1031	1129	1.52e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105421
AA Change: S295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: S295F

Domain	Start	End	E-Value	Type
low complexity region	80	90	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
coiled coil region	238	281	N/A	INTRINSIC
low complexity region	359	373	N/A	INTRINSIC
coiled coil region	395	450	N/A	INTRINSIC
coiled coil region	488	808	N/A	INTRINSIC
low complexity region	829	841	N/A	INTRINSIC
low complexity region	972	993	N/A	INTRINSIC
CH	1014	1112	1.52e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218766
AA Change: S278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218876

Predicted Effect

probably benign
Transcript: ENSMUST00000219387

Meta Mutation Damage Score

0.4350

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	A	10: 28,981,579	Q194L	probably damaging	Het
Acsf2	T	A	11: 94,558,873	K574*	probably null	Het
Adam22	T	C	5: 8,121,108	E614G	probably damaging	Het
Ap4e1	T	C	2: 127,047,163		probably null	Het
Arid3c	T	A	4: 41,724,744	I364F	probably damaging	Het
Bcan	T	A	3: 87,993,094	S611C	probably damaging	Het
Birc6	T	C	17: 74,602,971	V1453A	probably benign	Het
Carnmt1	T	C	19: 18,703,370	L336P	probably damaging	Het
Ccdc146	C	A	5: 21,399,721	D40Y	probably benign	Het
Ccdc83	C	T	7: 90,224,077	V357I	probably damaging	Het
Cdh22	A	T	2: 165,143,847		probably null	Het
Cdk5rap2	A	C	4: 70,266,678	S1178R	probably benign	Het
Cdkl3	T	C	11: 52,032,495	V45A	probably benign	Het
Chd7	A	G	4: 8,785,532	D612G	probably damaging	Het
Chst11	T	C	10: 83,191,170	Y144H	probably damaging	Het
Cops6	A	T	5: 138,161,141	N10I	probably benign	Het
Cyfip1	G	T	7: 55,899,957	R624L	probably null	Het
Cyp27a1	A	G	1: 74,736,687	N344D	probably damaging	Het
Des	T	G	1: 75,363,493	M348R	probably damaging	Het
Dis3l	T	A	9: 64,330,883	D109V	probably damaging	Het
Disp3	C	T	4: 148,271,602	R267Q	possibly damaging	Het
Dnah3	T	A	7: 119,975,129	I2136F	probably benign	Het
Dnah9	T	C	11: 66,112,362	D872G	probably benign	Het
Dnajb14	G	A	3: 137,885,380	G31S	probably benign	Het
Dopey1	T	G	9: 86,494,418	V235G	probably damaging	Het
Efcab6	T	A	15: 83,946,999	R571S	probably benign	Het
Emsy	T	G	7: 98,626,623	K352N	probably damaging	Het
Erbb4	T	C	1: 68,198,888	N814S	probably damaging	Het
Fam71e2	T	A	7: 4,758,187	T509S	probably benign	Het
Fgfbp1	T	A	5: 43,979,330	M207L	probably benign	Het
Filip1	T	C	9: 79,819,930	E469G	probably damaging	Het
Garem2	T	G	5: 30,116,974	L777R	probably damaging	Het
Gm8394	A	G	10: 85,313,731		noncoding transcript	Het
Gm884	T	C	11: 103,614,207	T2312A	possibly damaging	Het
Hkdc1	T	C	10: 62,417,898	T35A	probably benign	Het
Hps6	C	T	19: 46,005,682	A686V	possibly damaging	Het
Irs1	T	C	1: 82,288,459	S679G	probably benign	Het
Ism1	T	A	2: 139,757,373	I415N	probably damaging	Het
Kdm1b	TCATTGTCC	TCATTGTCCATTGTCC	13: 47,064,088		probably null	Het
Kpna1	G	A	16: 36,031,221	A392T	probably damaging	Het
Lipa	T	A	19: 34,510,890	R119*	probably null	Het
Mocs1	A	T	17: 49,449,109	K198M	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msh5	A	G	17: 35,044,390	I154T	probably benign	Het
Muc6	T	A	7: 141,637,510	T2417S	possibly damaging	Het
Ncbp2	T	C	16: 31,956,951	Y138H	probably damaging	Het
Ndufv1	C	A	19: 4,008,347	R359L	probably benign	Het
Neu3	G	C	7: 99,813,443	R358G	probably benign	Het
Ntrk3	A	C	7: 78,516,723		probably null	Het
Olfr1045	A	G	2: 86,197,817	F312L	probably benign	Het
Olfr351	G	A	2: 36,859,625	S241F	probably damaging	Het
Olfr870	T	A	9: 20,171,409	H54L	possibly damaging	Het
Pik3c2b	T	C	1: 133,103,428	S1491P	probably benign	Het
Plb1	G	T	5: 32,293,242	D376Y	probably damaging	Het
Plch1	T	A	3: 63,744,535	K378N	probably damaging	Het
Plekhm1	C	T	11: 103,387,122	E383K	probably benign	Het
Plxnb1	T	C	9: 109,102,708		probably null	Het
Prkdc	A	G	16: 15,654,817		probably null	Het
Prpf8	T	A	11: 75,495,363	V946E	probably damaging	Het
Ptprh	C	A	7: 4,603,133		probably benign	Het
Rngtt	T	A	4: 33,500,302	C565*	probably null	Het
Sacs	A	G	14: 61,204,660	H1385R	probably benign	Het
Sec24a	A	G	11: 51,716,450	S656P	possibly damaging	Het
Serpinb13	A	T	1: 106,999,026	I251L	possibly damaging	Het
Shc1	G	A	3: 89,423,542	G91S	probably damaging	Het
Sin3b	T	A	8: 72,733,419	N211K	probably benign	Het
Slc22a2	A	T	17: 12,586,805	M148L	probably benign	Het
Slc3a1	G	A	17: 85,063,792	V591I	probably benign	Het
Slc47a2	A	T	11: 61,328,526		probably null	Het
Spag17	C	T	3: 100,106,797	P2129S	probably damaging	Het
Sphkap	T	A	1: 83,257,221	D1628V	probably damaging	Het
Themis3	C	T	17: 66,555,704	V420I	possibly damaging	Het
Ttc39d	A	G	17: 80,217,246	K445E	probably damaging	Het
U2surp	T	C	9: 95,491,420	E232G	possibly damaging	Het
Usp25	T	A	16: 77,076,429	F458L	probably damaging	Het
Usp7	T	C	16: 8,698,469	S649G	probably benign	Het
Vmn1r10	A	G	6: 57,114,103	T227A	probably damaging	Het
Zcchc12	C	T	X: 36,198,465	T345M	possibly damaging	Het
Zfp444	T	C	7: 6,189,555	C191R	probably damaging	Het
Zfp729b	A	T	13: 67,592,233	C648S	probably damaging	Het
Zfp799	A	G	17: 32,821,803	Y58H	probably damaging	Het
Zfp938	C	T	10: 82,225,547	G413D	probably damaging	Het

Other mutations in Specc1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00549:Specc1l	APN	10	75246221	missense	probably benign	0.12
IGL01638:Specc1l	APN	10	75246205	nonsense	probably null
IGL01970:Specc1l	APN	10	75245761	missense	probably damaging	1.00
IGL02539:Specc1l	APN	10	75267508	missense	probably benign	0.39
IGL02737:Specc1l	APN	10	75246324	missense	probably damaging	0.99
IGL02941:Specc1l	APN	10	75241188	missense	probably benign	0.10
R0305:Specc1l	UTSW	10	75245829	missense	probably damaging	1.00
R0374:Specc1l	UTSW	10	75248459	missense	probably damaging	0.99
R0402:Specc1l	UTSW	10	75246426	missense	probably damaging	1.00
R1456:Specc1l	UTSW	10	75246284	missense	probably damaging	0.98
R1508:Specc1l	UTSW	10	75307238	missense	probably benign	0.00
R1861:Specc1l	UTSW	10	75309859	missense	probably damaging	1.00
R1869:Specc1l	UTSW	10	75261825	missense	probably damaging	1.00
R1929:Specc1l	UTSW	10	75245604	missense	probably damaging	1.00
R1930:Specc1l	UTSW	10	75309824	missense	probably damaging	1.00
R2021:Specc1l	UTSW	10	75267591	critical splice donor site	probably null
R2209:Specc1l	UTSW	10	75246576	missense	probably damaging	1.00
R2937:Specc1l	UTSW	10	75259131	missense	probably damaging	0.98
R4415:Specc1l	UTSW	10	75246328	missense	possibly damaging	0.92
R4758:Specc1l	UTSW	10	75246348	missense	probably damaging	0.99
R5344:Specc1l	UTSW	10	75246173	missense	possibly damaging	0.84
R5383:Specc1l	UTSW	10	75246705	missense	possibly damaging	0.86
R5426:Specc1l	UTSW	10	75267550	missense	probably benign	0.21
R5774:Specc1l	UTSW	10	75245400	missense	probably damaging	1.00
R5788:Specc1l	UTSW	10	75276921	missense	probably damaging	1.00
R6101:Specc1l	UTSW	10	75248632	missense	probably damaging	1.00
R6105:Specc1l	UTSW	10	75248632	missense	probably damaging	1.00
R6136:Specc1l	UTSW	10	75246660	missense	probably benign	0.38
R6345:Specc1l	UTSW	10	75248488	missense	probably damaging	0.99
R6459:Specc1l	UTSW	10	75246167	missense	probably damaging	1.00
R6641:Specc1l	UTSW	10	75246549	missense	probably damaging	1.00
R6996:Specc1l	UTSW	10	75246279	missense	probably benign	0.23
R7100:Specc1l	UTSW	10	75245495	missense	probably benign	0.21
R7475:Specc1l	UTSW	10	75246447	missense	possibly damaging	0.59
R7545:Specc1l	UTSW	10	75245087	missense	probably benign	0.00
R7615:Specc1l	UTSW	10	75263286	missense	probably benign	0.02
R7635:Specc1l	UTSW	10	75276804	missense	probably damaging	1.00
R7640:Specc1l	UTSW	10	75257869	missense	probably damaging	1.00
R7682:Specc1l	UTSW	10	75245802	missense	probably damaging	0.99
R7711:Specc1l	UTSW	10	75230808	missense	probably benign	0.02
R7742:Specc1l	UTSW	10	75246417	missense	probably benign	0.01
X0021:Specc1l	UTSW	10	75274040	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCATTAGTGAGGACCATTGTG -3'
(R):5'- TCCAGGTTGTCCATGGAGTTAC -3'

Sequencing Primer
(F):5'- CATTAGTGAGGACCATTGTGAAGGTG -3'
(R):5'- ACTGTGCTGATGGTCCATGAG -3'

Posted On

2014-10-16